1
answer
1
watching
1,760
views
26 Dec 2018

Write a brief outline of the mechanisms in which DNA is used to generate protein. You do not need to provide a fine level of detail, but ensure you reflect on the key points in the process and mention any major differences between the mechanism in prokaryotic and eukaryotic cells.

Although the DNA in our genes is considered to be the heritable genetic material, other factors, including the environment are considered to play an important role in the activity and expression of those genes. Summarize the role that epigenetics & developmental epigenetics play in health & disease.

Finally - using the codon table found on page 402 of the textbook, translate these two almost identical RNA strands into peptide sequences, using the first base of each as the first triplet in a codon. You will notice that the second strand has a point deletion (the u in bold) with respect to the first strand – comment on how this has affected the resulting peptide chain.

aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc

aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc

For unlimited access to Homework Help, a Homework+ subscription is required.

Patrina Schowalter
Patrina SchowalterLv2
27 Dec 2018

Unlock all answers

Get 1 free homework help answer.
Already have an account? Log in
Start filling in the gaps now
Log in