Page 12 of Bio 2050

A. What is CRISPR?

B. What is the key feature of the CRISPR enzyme that allows it to change a specific DNA sequence?

C. What are GMOs? Give an example.

D. How different is the DNA sequence from one person to another?

E. What is DNA methylation? How does this process influence gene expression?

answer

watching

views

For unlimited access to Homework Help, a Homework+ subscription is required.

You have 0 free answers left.
Get unlimited access to 3.8 million step-by-step answers.

Get unlimited access

Already have an account? Log in

Lelia LubowitzLv2

29 Sep 2019

Unlock all answers

Get 1 free homework help answer.

Already have an account? Log in

Related questions

Epigenetic modifications to DNA sequences and resulting alterations in chromatin structure can be analyzed by examining DNA methylation and histone modifications. To examine methylation of a DNA sequence, you treat it with sodium bisulfite. a.) If your original DNA sequence is: ACAGTCCGTCGGAGCCTGCCAGTCGCACCT and your sequence after treatment reads: ACAGTTCGTCGGAGCTTGTTAGTCGCACTT, which positions on the original DNA sequence are methylated? (Indicate methylations with an * after the affected nucleotide) b.) When this DNA sequence is replicated, which of these methylations will be transferred to a new sequence? Indicate what the new sequence will be in the standard 5' to 3' direction. c.) How does an increase in DNA methylation affect chromatin structure and what does this do to gene expression? Be specific. d.) Describe how chromatin structure is altered in the process of X-inactivation and how the active X-chromosome prevents itself from being inactivated. Include the functions of Jpx, Xist, Tsix, and describe what each of these gene products do. Be specific.

Genetics Question

DNA Methylation

A. Name two mechanisms by which it inhibits gene expression

B. How can it activate gene expression?

C. How is methylation passed from one cell to its daughter?

D. How does methylation from the mother and father affect expression of the IGF2 gene?

E. When does imprinting get erased during the life cycle and when does it get established again? Is it completely erased?

brownclam469

1. How does DNA copy itself through the process ofreplication? What is meant by semi-conservativereplication?

2. What is the process of transcription? What is therole of mRNA and how does it relate to DNA?

3. What is the process oftranslation? What is the role of the ribosome and tRNA? How manyRNA nucleotides âcodeâ for an amino acid? How are the amino acidsconnected to make proteins?

4. How many amino acids are there? Is there more thanone codon for each amino acid?

5. Describe how a change in DNA sequence could result ina changed sequence of amino acids in a protein.

6. What is a regulatory region in DNA and how can itcontrol gene expression?

7. What is a transgenic organism?