Log in
Biology
1
answer
0
watching
270
views

1. How does DNA copy itself through the process ofreplication? What is meant by semi-conservativereplication?

2. What is the process of transcription? What is therole of mRNA and how does it relate to DNA?

3. What is the process oftranslation? What is the role of the ribosome and tRNA? How manyRNA nucleotides “code” for an amino acid? How are the amino acidsconnected to make proteins?

4. How many amino acids are there? Is there more thanone codon for each amino acid?

5. Describe how a change in DNA sequence could result ina changed sequence of amino acids in a protein.

6. What is a regulatory region in DNA and how can itcontrol gene expression?

7. What is a transgenic organism?

Watch
1
answer
0
watching
270
views

For unlimited access to Homework Help, a Homework+ subscription is required.

Nestor Rutherford
Nestor RutherfordLv2
28 Sep 2019

Unlock all answers

Get 1 free homework help answer.
Already have an account? Log in
Share

Related textbook solutions

Molecular Cell Biology
8 Edition,
Lodish
ISBN: 9781464183393
Biology: Science for Life with Physiology
6 Edition,
Belk
ISBN: 9780134555430
Concepts of Biology
OER Edition,
Openstax
ISBN: 9781938168116
Biology
2nd Edition, 2013
Openstax
ISBN: 9781947172517
Essentials of Biology
5 Edition,
Mader
ISBN: 9781259660269

Related questions

Unit 2: Genetics Assignment

In this assignment you will convert a DNA sequence into proteins through several steps. If you have no idea where to begin I recommend that you watch the “How to read the Genetic Code” and “Protein Synthesis” videos

Here is the DNA sequence:

TACCACGCCAAGCGAAGCGGGATT

Part 1: Transcribe the sequence into mRNA and separate the mRNA into codons. Name the enzyme responsible and the start and stop codons used.

Part 2: Give the tRNA anticodons that match the mRNA.

Part 3: Translate the mRNA into amino acids.

Part 4: Give an example of how a mutation to this sequence could cause a silent mutation.

Here’s an example that you can complete:

Normal DNA = CAC Mutated DNA = CAG

Normal mRNA = Mutated mRNA=

Normal amino acid = Mutated amino acid=

*What do you notice happened above?

*What does this tell you about the effect of a silent mutation?

Part 5: Give an example of how a mutation to this sequence could cause a missense mutation.

Here’s an example that you can complete:

Normal DNA = CAC Mutated DNA = GAC

Normal mRNA = Mutated mRNA=

Normal amino acid = Mutated amino acid=

*What do you notice happened above?

*What does this tell you about the effect of a missense mutation?

Part 6: Besides mutations how else do bacteria acquire new genes? Define each of these in your own words:

*transformation

*transduction

*conjugation

1. _________________________ is the name of the process that produces proteins using RNA molecules.

a.Transcription

b Translation

c. Replication

d. Mutagenesis

2. The peptide bonding site on the ribosome:

a. A site

b. P site

c. E site

d. D site

3. The name given to the bond formed between two amino acids.

a. Hydrogen bond

b. Double bond

c. Peptide bond

d. Negative bond

4. __________________________ is the movement of the mRNA molecule on the ribosome to open up the A-site for the new incoming amino acid.

a. Transformation

b. Mutation

c. Translocation

d. Initiation

5. What does the term semi-conservative mean.

a. Replication of RNA is semi-conservative, each new strand consists of one old strand of RNA and one new strand of RNA.

b. Replication of DNA is semi-conservative, each new strand consists of one old strand of DNA and one new strand of DNA.

c. Replication of DNA is semi-conservative, each new strand consists of new strands of nucleotides.

d. Transcription of RNA is semi conservative.

6. This molecule functions during protein synthesis to recognize the codon and bring the proper amino acid back to the ribosome for translation.

a. mRNA

b. tRNA

c. rRNA

d. DNA polymerase

7. What is meant by the base-pairing rule.

a. Bases on a single strand of DNA are always found as pairs

b. Adenine always base pairs with guanine; cytosine with thymine

c. Adenine always base pairs with thymine; cytosine with guanine

d. Bases on a single strand of RNA are found in pair.

8. In this step of protein synthesis, amino acids are added to a growing polypeptide chain.

a. Initiation.

b. Elongation.

c. Termination.

d. Transpiration.

9. Three complementary bases found in a mRNA are called ____________________.

a. Anti-codon.

b. Triplet.

c. Doublet.

d. Codons.

10. Which statement best describes the job or function of the messenger RNA.

a. Carries the map of the gene sequence in the form of codons to the cytoplasm

for translation of the protein.

b. It transfers amino acids to the ribosome for protein synthesis.

c. It forms the ribosomes.

d. It helps replicate DNA.

Which of the following is NOT a direct consequence of the fact that DNA polymerase can only build onto the end of an existing nucleic acid?

Question 6 options:

DNA replication requires primers

Bits of DNA are lost from the ends of your chromosomes in each successive round of replication

RNA is involved in DNA replication

The enzyme "primase" is needed for DNA replication

There are multiple origins of replication on each eukaryotic chromosome

How does a nucleotide sequence code for a protein in nearly all living organisms?

Question 7 options:

a sequence of 3 nucleotides can code for one of 64 different amino acids

a sequence of 2 nucleotides can code for one of 64 different amino acids

a sequence of 2 nucleotides can code for one of 20 different amino acids

a sequence of 3 nucleotides can code for one of 20 different amino acids

a sequence of 3 nucleotides can code for 3 different amino acids

Fill in the blanks. To make one strand of DNA, _________ monomers are linked together in a chain, forming a polymer we call a(n) ________ .

Question 8 options:

nitrogenous bases, hydrogen bond

nucleotide, nucleic acid

amino acid, nucleic acid

nucleotide, nitrogenous base

amino acid, protein

Which of the following was NOT part of the ideas that Darwin used in his book On the Origin of Species?

Question 9 options:

organisms vary in characteristics that affect survival and reproduction

variation in traits is often heritable

descent with modification explains life's unity and life's diversity

organisms inherit characteristics from their parents that the parents acquired in their own lifetimes

natural selection is a cause of adaptive evolution

Here is a hypothetical mRNA sequence:

5' G G A U G C U A G U A U G A 3'

What is the amino acid sequence encoded by this mRNA?

Question 10 options:

Met-Ile-Val

Asp-Ala-Ser-Met

Met-Leu-Val

Ser-Met-Ile-Val

Gly-Cys

Weekly leaderboard

Home
Homework Help 3,900,000
Biology 460,000
Start filling in the gaps now
Log in