A promoter is a DNA sequence that is upstream of a gene. Promoters comprise about 35 base pair consensus sequences that are required for transcription initiation. The figure from the textbook shows the positions of the consensus sequences in a promoter:

Predict and explain the possible effect of a mutation on the transcription at the following locations:

-7

-19

-32

+1

answer

watching

173

views

For unlimited access to Homework Help, a Homework+ subscription is required.

You have 0 free answers left.
Get unlimited access to 3.8 million step-by-step answers.

Get unlimited access

Already have an account? Log in

Beverley SmithLv2

21 Mar 2018

Unlock all answers

Get 1 free homework help answer.

Already have an account? Log in

Related questions

You have discovered a new gene âXâ that appears to be regulated by 3 transcription factors (E2F, SP-1 and C/EBPa). Another gene âYâ appears to also be regulated by these same proteins. Both genes are involved in cell cycle initiation but gene Y is expressed later in the cell cycle than gene X.

The DNA sequence at the promoter region is GCGCCAATGTGCTGACAGTTAATTAGGGCTA

The known DNA consensus sequence for each Transcription Factor is:

E2F â GCCAATGTGCTGA

SP-1 â GCTGACAGTTAA

C/EBPa â ACAGTTAATTAGG

It is not known which protein(s) are binding to their respective DNA consensus sequences. It is possible for one protein to be interacting with one another and not directly to the DNA. It is also possible for a transcription factor to use all or only a majority of the DNA consensus sequence. Both scenarios are possible. Discuss in general how protein:DNA and potein:protein interactions occur at the molecular level. Propose an explanation for what you believe may be happening and then design a series of experiments that will investigate the regulation of Gene X and Gene Y. All proteins and gene sequences are known. You have a large well-funded lab.

1 DNA sequences found in introns provide [A] amino acid sequence information.

[B] regulatory information.
[C] no known useful information.

[D] structure for the gene.
[E] alternative DNA splicing possibilities.

3. The TATA box is a(n)
[A] sequence close to the promoter region of many genes.
[B] square-shaped sequence.
[C] enhancer consensus sequence.
[D] activator sequence necessary for proper translation.
[E] None of the above

5. Regarding genes and gene expression, which of the following is not a difference between prokaryotes and eukaryotes
[A] Eukaryotic DNA does not contain a TATA box close to the initiation site as does prokaryotic DNA.

[B] In eukaryotes, RNA polymerase requires

'transcription factors'or initiation.

[C] Prokaryotic genes are often grouped together in

operons.

[D] In eukaryotes, the regulation of several genes at once requires common control elements in each of the genes.
[E] There is a diversity of eukaryotic polymerases that is reflected in the diversity of eukaryotic promoters.

10) In eukaryotic cells, a repressor

[A] is made of DNA.
[B] binds to the enhancer region to block transcription. [

C] is located both upstream and downstream from the promoter.
[D] binds to the operator to block RNA polymerase.

[E] binds to a silencer to reduce transcription rates.

Coordinated regulation of genes in eukaryotic cells [A] is the result of positioning the same regulatory sequence in front of each gene.
[B] results from all of those genes being under the control of one promoter.

[C] occurs because related genes all have the same

operons.
[D] occurs because enhancers cause DNA to bend.

Match the following:

1	Region which lies upstream of thetranslation start site contains the Shine Dalgarno sequence
2	Sequence added to the 3' end of thepre-mRNA which affects mRNA stability
3	Establishes the reading frame andspecifies the first amino acid of the protein chain
4	DNA sequence that the transcriptionapparatus recognizes and binds to initiate transcription
5	Expressed sequences of DNA that arenot removed during alternative splicing
6	Signals the end of translation andthe protein molecule
7	Group of three nucleotides that codefor an amino acid
8	Site begins the coding region of thegene and is located 25-30 nucleotides downstream of the TATAbox
9	Non-coding sequences of DNA thatintervene within coding regions of a gene
	10 Ribosome binding site ineukaryotes; functions in the initiation of translation and mRNAstability
11	A sequence which lies downstream ofthe coding region of the gene; determines the location of the 3'cleavage site in the pre-mRNA molecule
12	Sequence of nucleotides at the 3' endof the mRNA that is not translated into protein; affects thetranslation and stability of the mRNA molecule

A.	5' untranslated region
B.	AAUAAA consensus sequence
C.	Promoter
D.	Transcription start site
E.	3' untranslated region
F.	Introns
G.	Initiation codon (AUG)
H.	Poly(A) tail
I.	5' cap
J.	Termination codon (UAA, UGA, UAG)
K.	Exons
L.	Sense codon