You have discovered a new gene âXâ that appears to be regulated by 3 transcription factors (E2F, SP-1 and C/EBPa). Another gene âYâ appears to also be regulated by these same proteins. Both genes are involved in cell cycle initiation but gene Y is expressed later in the cell cycle than gene X.
The DNA sequence at the promoter region is GCGCCAATGTGCTGACAGTTAATTAGGGCTA
The known DNA consensus sequence for each Transcription Factor is:
E2F â GCCAATGTGCTGA
SP-1 â GCTGACAGTTAA
C/EBPa â ACAGTTAATTAGG
It is not known which protein(s) are binding to their respective DNA consensus sequences. It is possible for one protein to be interacting with one another and not directly to the DNA. It is also possible for a transcription factor to use all or only a majority of the DNA consensus sequence. Both scenarios are possible. Discuss in general how protein:DNA and potein:protein interactions occur at the molecular level. Propose an explanation for what you believe may be happening and then design a series of experiments that will investigate the regulation of Gene X and Gene Y. All proteins and gene sequences are known. You have a large well-funded lab.
You have discovered a new gene âXâ that appears to be regulated by 3 transcription factors (E2F, SP-1 and C/EBPa). Another gene âYâ appears to also be regulated by these same proteins. Both genes are involved in cell cycle initiation but gene Y is expressed later in the cell cycle than gene X.
The DNA sequence at the promoter region is GCGCCAATGTGCTGACAGTTAATTAGGGCTA
The known DNA consensus sequence for each Transcription Factor is:
E2F â GCCAATGTGCTGA
SP-1 â GCTGACAGTTAA
C/EBPa â ACAGTTAATTAGG
It is not known which protein(s) are binding to their respective DNA consensus sequences. It is possible for one protein to be interacting with one another and not directly to the DNA. It is also possible for a transcription factor to use all or only a majority of the DNA consensus sequence. Both scenarios are possible. Discuss in general how protein:DNA and potein:protein interactions occur at the molecular level. Propose an explanation for what you believe may be happening and then design a series of experiments that will investigate the regulation of Gene X and Gene Y. All proteins and gene sequences are known. You have a large well-funded lab.
