what is the significance of the start and stop codons in protein synthesis ?
For unlimited access to Homework Help, a Homework+ subscription is required.
Attempt this question only if you can give complete explanation to your choice. This is biology/genetics question
If an mRNA contains a protein-Ââcoding sequence that has 33 codons (including the start and stop codons), how many amino acids will be in the protein that is produced from translation of that mRNA?
a. 99
b. 32
c. 33
d. 11
e. 0
strand of DNA that makes a completepolypeptide (includes start to stop codons)
give the resulting amino acid chain (provide brief explanation)
TAACATCTACTTACTAGATAGCTCAAGAAGAAGAAGATCCTTGAACGAATCG
Show amino acid FASTA files for 4 bacterial genes
Annotate the start codons for 4 bacterial genes
Annotate the stop codons for 4 bacterial genes
Find a bacterial promoter sequence