Log in
Biology
1
answer
0
watching
35
views

strand of DNA that makes a completepolypeptide (includes start to stop codons)

give the resulting amino acid chain (provide brief explanation)


TAACATCTACTTACTAGATAGCTCAAGAAGAAGAAGATCCTTGAACGAATCG

Watch
1
answer
0
watching
35
views

For unlimited access to Homework Help, a Homework+ subscription is required.

Nestor Rutherford
Nestor RutherfordLv2
28 Sep 2019

Unlock all answers

Get 1 free homework help answer.
Already have an account? Log in
Share

Related textbook solutions

Molecular Cell Biology
8 Edition,
Lodish
ISBN: 9781464183393
Biology: Science for Life with Physiology
6 Edition,
Belk
ISBN: 9780134555430
Biology
2nd Edition, 2013
Openstax
ISBN: 9781947172517
Concepts of Biology
OER Edition,
Openstax
ISBN: 9781938168116
Essentials of Biology
5 Edition,
Mader
ISBN: 9781259660269

Related questions

Given the following sequence of the coding strand, written in standard 5' to 3' orientation, locate the start codon.

CGTTATGTTATGGACTCTCTGGTATGACTCACCT

Starting with and including the start codon, you should have determined the sequence of the protein that would be produced by this in the previous question. What percentage of amino acids in this sequence is coded by a "rare" amino acid — i.e., and amino acid with is encoded by <4 codons? (Enter an integer number between 0 and 100, rounding up if necessary).

-----

Could somebody explain in greater detail what a "rare" amino acid is and possibly provide a link to a table? I know the start codon is ATG, but believe the i.e. section of this question is miswritten. Do they mean an amino acid chain that is composed of less than 4 codons, or is there something I'm missing? Any assistance would be appreciated.

Attempt this question only if you can give complete explanation to your choice. This is biology/genetics question

If an mRNA contains a protein-­‐coding sequence that has 33 codons (including the start and stop codons), how many amino acids will be in the protein that is produced from translation of that mRNA?

a. 99

b. 32

c. 33

d. 11

e. 0

1. What was the purpose of using blender to liquefy the onion before adding the DNA lysis. 2. What was the purpose of heating the onion solution before filtering it it and adding the ethanol? 3. what was the purpose of adding ethanol to the filtered DNA solution. 4. what is the template DNA for the following RNA strand. AUGCCGAUCCGUUAAG 5. If the RNA in the previous strand were translated, what would the order of the amino acid chain be? 6. List one possible mRNA strand that would code for the following amino acid chain: Mathionine, proline, glycine, glutamic acid, alanine. Don't forget to add the stop codon. 7.List the template DNA that would correspond to the mRNA strand in the previous question. 8. What amino chain would the following template DNA strand code for:--T A C G G C C C C G G A T T A A T T-? show your work?

Weekly leaderboard

Home
Homework Help 3,900,000
Biology 460,000
Start filling in the gaps now
Log in