1. The following sequence is one strand of DNA from a region of the chromosome that contains the start of transcription (including +1) of a gene in E. Coli.
A. Is the segment shown the template or non template (coding) strand?

B. Predict where transcription will start and what will be the sequence of the RNA transcript.

5â CGGGCAACGTCATTATACGA 3â

2.. A mutation changes the start codon of the gene for lac depressor (laci) to a stop codon. How would this affect transcription of the lac operon? How would it affect the cells ability to utilize lactose?

answer

watching

254

views

For unlimited access to Homework Help, a Homework+ subscription is required.

You have 0 free answers left.
Get unlimited access to 3.8 million step-by-step answers.

Get unlimited access

Already have an account? Log in

Lelia LubowitzLv2

21 Apr 2019

Unlock all answers

Get 1 free homework help answer.

Already have an account? Log in

Related questions

2) For the hypothetical DNA sequence/gene below mark the start codon and the stop codon of the gene. TSS->

5âCATAAA| GCAAACAGGAGATGGGCCCCAAAAGCCATGAATGGGAGCGCGTATAATCATGATTTATAATCTAGG TATCTCACTGA3â

3âGTATTT| CTTTTGTCCTCTACCCGGGGTTTTCGGTACTTACCCTCGCGCATATTAGTACTAAATATTAGATCC ATAGAGTGACT5â

Terminator sequence

Promoter sequence

TSS-> transcription start site and direction of transcription

a) Which strand of the DNA shown above, the top or the bottom, is the template strand?

b) What is the sequence of the mRNA produced from this gene? Label the 5â and 3â ends.

c) What is the sequence of the protein produced from the mRNA in (b)? Label the N and C termini.

d) Generate two examples each that result in a silent mutation, a missense mutation, a nonsense mutation, and a frameshift mutation for the DNA sequence above. Show the respective amino acids below each codon. (Courier font is a font typically used for sequences.)

ochrecrab921

Below is a DNA sequence that is a template strand and contains an Open reading frame for a gene:

3â TAAACTGTACAGGGCCATAACT 5â

A. Find the open reading frame and circle the start and stop codon.

B. Transcribe the open reading frame into a strand of mRNA

C. What is the peptide encoded by this strand of mRNA?

D. Consider the 2nd translated codon from the mRNA strand. What is the probability that a single base change in any position of this codon would change the identity of the second amino acid in the protein sequence?

1) In the wildtype (the DNA sequence most commonly found in nature) lac operon, transcription is severely down-regulated. A mutation in lacI that causes an early stop codon in the sequence (called a lacI - strain) results in an operon that has high levels of transcription of the polycistronic m-RNA. What type of regulatory protein is the LacI protein (hint: we covered this type of protein in lecture)?

The Lac regulatory protein is called a repressor. (is this correct)

2) If a bacterium with a wildtype lac operon is grown in the presence of lactose, high levels of transcription result for a while, however, eventually transcription is again down-regulated. If, on the other hand, the sugar IPTG is present (instead of lactose), transcription levels are high and remain high. What function do IPTG and lactose share? How are they differently affected by the operon product? (need help with this question)

Lactose and IPTG affected by the operon are both inducers of the Lac-Operon. (is this correct)

3) What is âepigeneticsâ? What forms of gene regulation are usually involved in epigenetic control of a trait? Why do we have such a limited understanding of epigenetic processes? (need help with this question)

Epigenetics is the study of phenotype changes that do not change the DNA sequence. Genes can be turned on and off based on environment situations of past generations, (parents or even grandparents) were exposed. Examples of some environmental factors could be diet, stress, smoking, drinking alcohol, and diseases. Histone modification and methylation are usually involved in epigenetic control of a trait. (is this correct)