2) For the hypothetical DNA sequence/gene below mark the start codon and the stop codon of the gene. TSS->
5âCATAAA| GCAAACAGGAGATGGGCCCCAAAAGCCATGAATGGGAGCGCGTATAATCATGATTTATAATCTAGG TATCTCACTGA3â
3âGTATTT| CTTTTGTCCTCTACCCGGGGTTTTCGGTACTTACCCTCGCGCATATTAGTACTAAATATTAGATCC ATAGAGTGACT5â
Terminator sequence
Promoter sequence
TSS-> transcription start site and direction of transcription
a) Which strand of the DNA shown above, the top or the bottom, is the template strand?
b) What is the sequence of the mRNA produced from this gene? Label the 5â and 3â ends.
c) What is the sequence of the protein produced from the mRNA in (b)? Label the N and C termini.
d) Generate two examples each that result in a silent mutation, a missense mutation, a nonsense mutation, and a frameshift mutation for the DNA sequence above. Show the respective amino acids below each codon. (Courier font is a font typically used for sequences.)
2) For the hypothetical DNA sequence/gene below mark the start codon and the stop codon of the gene. TSS->
5âCATAAA| GCAAACAGGAGATGGGCCCCAAAAGCCATGAATGGGAGCGCGTATAATCATGATTTATAATCTAGG TATCTCACTGA3â
3âGTATTT| CTTTTGTCCTCTACCCGGGGTTTTCGGTACTTACCCTCGCGCATATTAGTACTAAATATTAGATCC ATAGAGTGACT5â
Terminator sequence
Promoter sequence
TSS-> transcription start site and direction of transcription
a) Which strand of the DNA shown above, the top or the bottom, is the template strand?
b) What is the sequence of the mRNA produced from this gene? Label the 5â and 3â ends.
c) What is the sequence of the protein produced from the mRNA in (b)? Label the N and C termini.
d) Generate two examples each that result in a silent mutation, a missense mutation, a nonsense mutation, and a frameshift mutation for the DNA sequence above. Show the respective amino acids below each codon. (Courier font is a font typically used for sequences.)
Related textbook solutions
Related questions
Part B
Think about the DNA coding sequence of a gene. If an A were swapped for a T, what kind of mutation could it cause and why?
| a) It could cause a frameshift nonsense or frameshift missense mutation because it would change the reading frame of the codon triplet. | ||||||||||||||||||||||||||||
| b) It could cause a silent, missense, or nonsense mutation because those are the types that can be caused by a nucleotide-pair substitution like this one. | ||||||||||||||||||||||||||||
| c) It could cause a nonsense mutation because the sequence would no longer be the same, so the protein would be shorter and non-functional. | ||||||||||||||||||||||||||||
| d) It could cause a silent mutation because A and T are complementary to each other so it is not really a substitution mutation. Part C Why is a frameshift missense mutation more likely to have a severe effect on phenotype than a nucleotide-pair substitution missense mutation in the same protein?
|
