Below is a DNA sequence that is a template strand and contains an Open reading frame for a gene:
3â TAAACTGTACAGGGCCATAACT 5â
A. Find the open reading frame and circle the start and stop codon.
B. Transcribe the open reading frame into a strand of mRNA
C. What is the peptide encoded by this strand of mRNA?
D. Consider the 2nd translated codon from the mRNA strand. What is the probability that a single base change in any position of this codon would change the identity of the second amino acid in the protein sequence?
Below is a DNA sequence that is a template strand and contains an Open reading frame for a gene:
3â TAAACTGTACAGGGCCATAACT 5â
A. Find the open reading frame and circle the start and stop codon.
B. Transcribe the open reading frame into a strand of mRNA
C. What is the peptide encoded by this strand of mRNA?
D. Consider the 2nd translated codon from the mRNA strand. What is the probability that a single base change in any position of this codon would change the identity of the second amino acid in the protein sequence?
For unlimited access to Homework Help, a Homework+ subscription is required.
Related textbook solutions
Related questions
Which of the following is the best characterization of the reading frame in gene expression?
Question 5 options:
The reading frame of a gene is set by the first three nucleotides in a gene's promoter. | |||||||||||||||||||||
Every gene has three possible reading frames, but all three specify the same protein. | |||||||||||||||||||||
Every gene has three possible reading frames, and thus encodes three different proteins. | |||||||||||||||||||||
The reading frame of a gene is set by the first three nucleotides at the 5' end of the mRNA. | |||||||||||||||||||||
The reading frame of a gene is set by the first AUG codon near the 5' end of the mRNA. Which of the following is/are NOT involved in initiating transcription in eukaryotes? Question 9 options:
|