Log in
Biology
3
answers
0
watching
17
views
19 Nov 2019

11.17 A segment of DNA in E. coli has the following sequence of nucleotide pairs:


When this segment of DNA is transcribed by RNA polymerase, what will be the sequence of nucleotides in the RNA transcript?

ANS: Assuming that there is a -35 sequence upstream from the consensus -10 sequence in this segment of the DNA molecule, the nucleotide sequence of the transcript will be 5?-ACCCGACAUAGCUACGAUGACGAUAAGCGACAUAGC-3?.

can somebody pls explain to me how to get that answer. thank you

Watch
3
answers
0
watching
17
views

For unlimited access to Homework Help, a Homework+ subscription is required.

Unlock all answers

Get 1 free homework help answer.
Get unlimited access
Already have an account? Log in
Share
Get unlimited access
Already have an account? Log in
Share
Collen Von
Collen VonLv2
22 Aug 2019
Get unlimited access
Already have an account? Log in
Share

Related textbook solutions

Molecular Cell Biology
8 Edition,
Lodish
ISBN: 9781464183393
Biology: Science for Life with Physiology
6 Edition,
Belk
ISBN: 9780134555430
Biology
2nd Edition, 2013
Openstax
ISBN: 9781947172517
Concepts of Biology
OER Edition,
Openstax
ISBN: 9781938168116
Essentials of Biology
5 Edition,
Mader
ISBN: 9781259660269

Related questions

1. The following sequence is one strand of DNA from a region of the chromosome that contains the start of transcription (including +1) of a gene in E. Coli.
A. Is the segment shown the template or non template (coding) strand?
B. Predict where transcription will start and what will be the sequence of the RNA transcript.

5’ CGGGCAACGTCATTATACGA 3’

2.. A mutation changes the start codon of the gene for lac depressor (laci) to a stop codon. How would this affect transcription of the lac operon? How would it affect the cells ability to utilize lactose?

The promoter region of a gene has undergone an inversion such that the 3′ end of the initiation site is upstream of the rest of the promoter sequence. This will affect the transcription of this gene in all the following ways except

a. the determination of the coding strand.

b. the orientation of the RNA polymerase.

c. the binding of RNA polymerase to the initiation site.

d. the separation of the double-stranded DNA.

e. the nucleotide with which transcription begins.

1. Which of the following is the correct sequence of events (from start to finish) in cellular fatty acid oxidation?

A. Fatty acid activationà carnitine shuttleà beta-oxidation

B. Beta-oxidationà carnitine shuttleà Fatty acid activation

C. Fatty acid activationà carnitine shuttleà beta-oxidation

D. Carnitine shuttleà Fatty acid activationà beta-oxidation

2. What reaction is catalyzed by lipoprotein lipase, or lipase?

A. Hydrolysis of TAGs into fatty acids and glycerol

B. Hydrolysis of TAGs into amino acids and glycerol

C. Hydrolysis of cholesterol in to fatty acid and water

D. Hydrolysis of cholesterol into acetyl-CoA

3. How do fatty acids of different carbon lengths cross into the mitochondrial matrix for oxidation?

A. Small FAs of 10 carbons or fewer can freely diffuse through the membrane

B. Large FAs are cleaved into two smaller units that are actively transported across the membrane

C. A membrane-bound transferase catalyzes the conversion of long-chain FAs and FA-carnitine esters, which are transported across the membrane via a specific carrier

D. The breakdown of large FAs starts outside the matrix, allowing for the smaller particles to pass easily through the membrane

4. How can any RNA nucleotide be easily distinguished from a DNA nucleotide?

A. RNA nucleotides have a unique phosphodiester bond linkage

B. RNA nucleotides have uracil nitrogenous bases

C. RNA nucleotides have an -OH on the 2’ carbon of the ribose

D. RNA nucleotides cannot be easily distinguished from DNA nucleotides

5. Which of the following statement is true concerning the sequence pTACGTAACGTA?

A. This is an RNA sequence

B. In order to have a more rigid structure in a double-stranded molecule, the sequence given would need more adenosine

C. If the complementary strand were present, the number of purines would be equal to the number of pyrimidines

D. The amount of purines is equal to the amount to pyrimidines

6. Complementary base pairing is considered which level of structure?

A. Secondary

B. Tertiary

C. Quaternary

D. Primary

7. Which of the following is/are required for the polymerization reaction catalyzed by DNA polymerase III?

I. RNA primer

II. DNA primer

III. RNA template

IV. DNA template

V. NTPs

VI. dNTPs

VII. Magnesium

VIII. Calcium

A. II, IV, V, and VII

B. II, IV, VI, and VII

C. I, IV, V, and VIII

D. I, IV, VI, and VII

8. DNA polymerase I, from E. coli, has three different catalytic sites. Which of the following is NOT one of them?

A. RNA-dependent RNA polymerase

B. RNA-dependent DNA polymerase

C. DNA-dependent RNA polymerase

D. DNA-dependent DNA polymerase

9. Eukaryotes solve the problem of replicating the ends of their linear chromosomes by:

A. Using a protein as primer

B. Enzyme activity that uses an RNA template and reverse transcription in a series of repeat cycles

C. All of the listed solution

D. Terminal redundancy whereby each end of the chromosome is duplicated allowing recombination

Weekly leaderboard

Home
Homework Help 3,900,000
Biology 460,000
Start filling in the gaps now
Log in