Log in
Biology
3
answers
1
watching
299
views

When chelating agents are used as anticoagulants, why is it vital that these agents bind divalent cations (ions with a 2+ charge)?

Watch
3
answers
1
watching
299
views

For unlimited access to Homework Help, a Homework+ subscription is required.

Unlock all answers

Get 1 free homework help answer.
Already have an account? Log in
Share
Already have an account? Log in
Share
Avatar image
Read by 1 person
Already have an account? Log in
Share

Related textbook solutions

Molecular Cell Biology
8 Edition,
Lodish
ISBN: 9781464183393
Biology: Science for Life with Physiology
6 Edition,
Belk
ISBN: 9780134555430
Biology
2nd Edition, 2013
Openstax
ISBN: 9781947172517
Concepts of Biology
OER Edition,
Openstax
ISBN: 9781938168116
Essentials of Biology
5 Edition,
Mader
ISBN: 9781259660269

Related questions

Which of the following is NOT a common side effect of circulatory medications? orthostatic hypotension and urinary frequency bradycardia fatigue, weakness, headaches, and dizziness anorexia, nausea, diarrhea, and constipation edema and shortness of breath Flag this Question Question 2 1 pts Which of the following is NOT true of HMG CoA reductase inhibitors? They are also called statins. They have few adverse reactions. The lowering of cholesterol and LDL with these medications is dose dependent. They may be discontinued when lipoprotein levels are lowered. They are used to reduce the progression of CAD, decrease cardiac problems, and decrease mortality. Flag this Question Question 3 1 pts Which of the following is NOT a type of angina pectoris? chronic exertional variant unstable all are types Flag this Question Question 4 1 pts Which of the following is NOT true regarding the treatment of cardiac dysrhythmias? Cardiac dysrhythmias are cured by the medications that are used in treatment. Cardiac dysrhythmias occur when calcium, sodium, and potassium ions that regulate the electrical impulses of the heart are disturbed. The medications for cardiac dysrhythmias are in four distinctive groups. Antidysrhythmics control rhythm by correcting or compensating for the altered rhythm. Alcohol and nicotine should be avoided while taking antidysrhythmics. Flag this Question Question 5 1 pts Antihypertensives receive the same response in all ethnic and cultural groups. True False Flag this Question Question 6 1 pts Which of the following is NOT true of adrenergic-inhibiting agents used in hypertension? They are the most frequently used medications for hypertension. They lower blood pressure and prevent serious cardiovascular complications. They include beta-blockers, alpha/beta-blockers, centrally and peripherally acting adrenergic inhibitors, and ACE inhibitors. They have few side effects and drug interactions. Some may also be used with angina pectoris. Flag this Question Question 7 1 pts Which of the following is NOT true of medications used to affect coagulation? Anticoagulants either may increase the time of coagulation or may be used to precipitate coagulation. Anticoagulants include vitamin K, heparin, and warfarin. Thrombolytic agents are used to promote the dissolution of thrombi. Antiplatelet drugs are used to inhibit the aggregation of platelets. Anticoagulants prevent venous clotting, while thrombolytics dissolve clots. Flag this Question Question 8 1 pts Which of the following is NOT true of anticoagulants? They may be given over prolonged periods of time without regard to prothrombin times. Warfarin is the oldest and most frequently used anticoagulant. Oral anticoagulants have a delayed onset of action. Patients taking anticoagulants must be watched carefully for excessive bruising, bloody stools, bleeding gums, and blood in the urine. Warfarin has a long list of drug interactions. Flag this Question Question 9 1 pts Antihypertensives cure hypertension. True False Flag this Question Question 10 1 pts Which of the following is NOT true of topical hemostatics? They are gelatin or cellulose sponges. They are used to absorb excess blood and fluids and to control bleeding in oral, dental, ophthalmic, and prostate surgery. They are ultimately absorbed by the body. The size and place of a wound have no bearing on which topical hemostatic agent is used. Some are powders, while others are foams, films, or surgical gauze.

1. How do intercalating agents such as ethidium bromide and cisplatin interact with DNA secondary structure? Why are these compounds toxic to cells? Reference your sources

2. Identify where one of the siRNA strands will bind to the mRNA.

mRNA

3’ AUGCCCGGAUGCUAUAGCGCGCAUCAUACGCAUUGCGAAUAUU 5’

siRNA

3’ AUUCGCAAUG 5’

5’ UAAGCGUUAC 3’

3. Assemble the secondary structure of this miRNA. Refer to figure 11.15 in the text to see what this might look like.

5’ CGCGAAGUUAUGAACGCUACGGGAACACGUUCAUAACUUCGUAAU 3’

6) Case Study: Cancer Drugs

DNA-damaging agents have a long history of use in cancer chemotherapy. The full extent of their cellular mechanisms, which is essential to balance efficacy and toxicity, is often unclear. In addition, the use of many anticancer drugs is limited by dose-limiting toxicities as well as the development of drug resistance. Novel anticancer compounds are continually being developed in the hopes of addressing these limitations; however, it is essential to be able to evaluate these compounds for their mechanisms of action.

a. One example of a DNA-damaging agent that interferes with DNA synthesis is aphidicolin. Knowing that it interferes with DNA synthesis, propose three hypotheses of how this agent might accomplish this (think about potential targets and mechanisms you have learned about in the cell).

b. Another set of DNA-damaging agents are alkylating agents, which either cross-link (create covalent bonds) between DNA and proteins or between DNA bases on the same or opposite strands. Hypothesize how these agents might specifically interfere with replication. Offer three different potential modes of action.

c. Clearly DNA replication is important for almost all the healthy cells in our body. How do these DNA-damaging agents manage not to kill the patient?

Weekly leaderboard

Home
Homework Help 3,900,000
Biology 460,000
Start filling in the gaps now
Log in