You have designed a PCR primer with the sequence ATTTTCGCGCGTAGG. The approximate Tm value for this primer is _____oC.

answer

watching

views

For unlimited access to Homework Help, a Homework+ subscription is required.

You have 0 free answers left.
Get unlimited access to 3.8 million step-by-step answers.

Get unlimited access

Already have an account? Log in

Beverley SmithLv2

27 Aug 2018

Unlock all answers

Get 1 free homework help answer.

Already have an account? Log in

Related questions

Please answer the following genetics questions pertaining to primers:

1.) What is the effect of primer length on a PCR reaction? Please fill in the blank for both (a) and (b) below:

a. Shorter than 18-20 bp: ________________________

b. Longer than 18-20 bp: ________________________

2.) How would you rate efficiency of a primer pair if the difference in Tm of the forward and reverse primers is more than 5Â°C apart?

3.) Define the problem of âprimer self-complementarity.â Also describe âprimer loopâ and âprimer dimerâ phenomena in the PCR reaction.

orangegnat260

Name 2 factors that affect the melting temperature (Tm) of a primer used in PCR. What step in the PCR reaction will be affected most by the Tm of the primers? What will happen if the temperature of this step is too high? too low?

raspberrymarten578

PCR Homework

Design a forward and a reverse primer ( 15 bases length ) to amplify the next DNA sequence

5âGGTGGTGCGCTTCCAAGAAGCAGCCAATAAGCAGAAGCAGGAACTCGACGAGATCTCGACGAATATTCGTCAGGCCGGCGTCCAATACTCGAGGGCCGACGAGGAGCAGCAGCAGGCGCTGTCCTCGCAAATGGGCTTCTGA3â

Name the reagents needed to do a PCR reaction

What is a DNA polymerase and why this enzyme from a thermoresistant microorganism must be used for the PCR?

The forward primer binds to the _____________ DNA chain and the ___________ primer bind to the main DNA chain that is the reason why we have to use the reverse _________ sequence to design the second primer