Please answer the following genetics questions pertaining to primers:
1.) What is the effect of primer length on a PCR reaction? Please fill in the blank for both (a) and (b) below:
a. Shorter than 18-20 bp: ________________________
b. Longer than 18-20 bp: ________________________
2.) How would you rate efficiency of a primer pair if the difference in Tm of the forward and reverse primers is more than 5°C apart?
3.) Define the problem of âprimer self-complementarity.â Also describe âprimer loopâ and âprimer dimerâ phenomena in the PCR reaction.
Please answer the following genetics questions pertaining to primers:
1.) What is the effect of primer length on a PCR reaction? Please fill in the blank for both (a) and (b) below:
a. Shorter than 18-20 bp: ________________________
b. Longer than 18-20 bp: ________________________
2.) How would you rate efficiency of a primer pair if the difference in Tm of the forward and reverse primers is more than 5°C apart?
3.) Define the problem of âprimer self-complementarity.â Also describe âprimer loopâ and âprimer dimerâ phenomena in the PCR reaction.
Related textbook solutions
Related questions
Please answer the following genetics question:
1.) The following is a partial coding sequence (only 360 bp) of the âhigh affinity nitrate transporterâ protein in wheat. Design both (a) forward and (b) reverse primer (each 20 bp long) that are capable of amplifying the entire 360 bp segment.
ATGGAGGTGCAGGCCGGCTCTCATGCCGACGCCGCGGCGAGCAAGTTCACGCTGCCGGTGGACTCCGAGCACAAGGCCAAGTCCTTCAGGCTCTTCTCCTTCGCCAACCCCCACATGCGCACCTTTCACCTCTCGTGGATCTCCTTCTTCACCTGCTTCGTCTCCACCTTTGCTGCGGCGCCCCTCGTGCCCATCATCCGCGACAACCTCAACCTTGCCAAGGCTGACATCGGCAATGCCGGTGTCGCGTCCGTGTCTGGGTCCATCTTCTCCAGGCTGGCCATGGGCGCTATCTGTGACTTGCTTGGCCCACGGTATGGTTGTGCCTTCCTCGTCATGCTCTCGGCACCGACCGTCTTC
| type | sequence |
| (a) Forward (Fwd) 5â > 3â | |
| (b) Reverse (Rev) 5â > 3â |
2.) The following represents a 600 bp portion of the coding sequence of the âhigh affinity nitrate transporterâ protein in wheat. Two primers as shown in the table are used in a successful PCR.
a. What DNA fragment size should we expect from this primer pair and this template?
| direction | sequence |
| Forward (Fwd) 5â > 3â | ATGGTTGTGCCTTCCTCGTC |
| Reverse (Rev) 5â > 3â | TTCTTTGGAGGCTCGCAAG |
TGCTGCGGCGCCCCTCGTGCCCATCATCCGCGACAACCTCAACCTTGCCAAGGCTGACATCGGCAATGCCGGTGTCGCGTCCGTGTCTGGGTCCATCTTCTCCAGGCTGGCCATGGGCGCTATCTGTGACTTGCTTGGCCCACGGTATGGTTGTGCCTTCCTCGTCATGCTCTCGGCACCGACCGTCTTCTGCATGGCCGTCATCGATGATGCCTCAGGGTACATCGCCGTCCGGTTCCTCATTGGCTTCTCCCTCGCCACCTTCGTGTCATGCCAATACTGGATGAGCACCATGTTCAATAGCAAGATCATTGGCACGGTCAATGGCTTGGCTGCAGGCTGGGGCAACATGGGTGGCGGCGCCACGCAGCTCATCATGCCGCTTGTCTTCCACGCAATCCAGAAGTGTGGCGCCACGCCCTTCGTGGCATGGCGTATTGCCTACTTCGTGCCGGGAATGATGCACATCGTGATGGGCTTGCTGGTCCTCACCATGGGGCAAGATCTCCCTGACGGGAACCTTGCGAGCCTCCARAAGAAGGGAGACATGGCCAAGGACAAGTTCTCCAAGGTCCTTTGGGGCGCYGTCACCAACTACCG
b. What is your explanation ifâbesides the true DNA fragmentâwe also see other DNA fragments as a result of this PCR reaction (For instance, we see bands at 500 bp and 2300 bp)?
