BIO 2306 Study Guide - Midterm Guide: Agarose Gel Electrophoresis, Restriction Digest, 5,6,7,8

Background info:

You have identified an organism with the smallest known genome (sequence below). You isolate the DNA and digest it with EcoR1

EcoRI --- 5' G ↓AATTC 3'

5' ACGACGTATTAGAATTCTTATCCGCCGCCGGAATTCTCATCA 3'

3’ TGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’

Look for palindromic site, specific for restriction enzyme, each strand of the DNA is “cut” (phosphodiester bond of backbone is cleaved) at the same place in the sequence, this will produce sticky ends

The key steps in the experiment:

1. Extract DNA from organism (how would you do this, can you separate protein and nucleic acids, what about DNA from RNA)

2. Incubate DNA with restriction enzyme (what is you used the wrong enzyme? What if you accidentally boiled your sample?

3. Use gel electrophoresis to separate out DNA fragments by size (need a gel, need an electrical current, buffer)

4. Use Ethidium Bromide (EtBr) either in the gel or as a stain afterwards (this will allow for visualization of the DNA, non-specific, ring structure intercalates with bases, excited by UV light, emits orange light)

5. Include a ladder/controls – (you need ladder or something of known size if you want to estimate the size of the fragments)

6. Visualize with UV light source and imager

7. Important – maybe not as key - Use loading dye when loading DNA buffer (the buffer helps the DNA settle into the well, dye lets you approximate where the DNA should be in the gel as it is running)

______________________________________________________________________________________

Here is the question I would like to know:

1) What would happen if we changed something in the experiment?

A) What would happen if we changed step 1?

b) What would happen if we changed step 2?

c) What would happen if we changed step 3?

d) What would happen if we changed step 4?
e) What would happen if we changed step 5?

f) What would happen if we changed step 6?

g) What would happen if we changed step 7 (if anything) ?

Background: Thelong, thick fibers of DNA store the information for the functioningof the chemistry of life. DNA is present in every cell of plantsand animals. The DNA found in strawberry cells can be extractedusing common, everyday materials. We will use an extraction buffercontaining salt, to break up protein chains that bind around thenucleic acids, and dish soap to dissolve the lipid (fat) part ofthe strawberry cell wall and nuclear membrane. This extractionbuffer will help provide us access to the DNA inside the cells.

Pre-labquestions:

What do you think the DNA will look like?

Where is DNA found?

Materials:

Heavy duty ziplocbag 10 mL DNA extraction buffer (soapy, salty water)

1strawberry glass rod, inoculating loop, or Popsicle stick

Cheeseclothfunnel 20 ml ethanol

50mL vial / test tube

Procedure:

1. Place one strawberry in aZiploc bag.

2. Smash/grind up thestrawberry using your fist and fingers for 2 minutes. Carefulnot to break the bag!!

3. Add the provided 10mL ofextraction buffer (salt and soap solution) to the bag.

4. Kneed/mush the strawberryin the bag again for 1 minute.

5. Assemble your filtrationapparatus as shown to the right.

6. Pour the strawberryslurry into the filtration apparatus and let it drip directly intoyour test tube.

7. Slowly pour cold ethanolinto the tube. OBSERVE

8. Dip the loop or glass rodinto the tube where the strawberry extract and ethanol layers comeinto contact with each other. OBSERVE

Conclusions and Analysis

It is important that you understand the steps in the extractionprocedure and why each step was necessary. Each step in theprocedure aided in isolating the DNA from other cellular materials.Match the procedure with its function:

2. What didthe DNA look like? Relate what you know about the chemicalstructure of DNA to what you observed today.

Explain what happened in the final step when you added ethanolto your strawberry extract.

(Hint: DNA is soluble in water, but not in ethanol)

A person cannot see a single cotton thread 100 feet away, but ifyou wound thousands of threads together into a rope, it would bevisible much further away. Is this statement analogous to our DNAextraction? Explain.

Why is it important for scientists to be able to remove DNA froman organism? List two reasons.

Is there DNA in your food? How do you know?

HELP ASAP;

Please help me understand my lab results, so be detailed to clearly understand . INclude answers to these questions what role does ampicilin (amp) and arabinose (ara) play in the experiment. Because GFP was isolated from jelly fisht, what modification to the GFP DNA had to be made to result in expression in E. coli?

BACKGROUND INFORMATION

Transformation of GFP and the pGLO Plasmid

GFP is a commonly used reporter protein in research labs, as the fluorescence creates a marker protein that can be used in many types of cell biology and biochemical studies. In basic research, GFP is often fused to a specific target protein of interest, creating a chimeric reporter protein. GFP has been used as a reporter protein to study blood vessel and tumor progression in mice, brain activity in mice, and malaria eradication in mosquitoes for instance (see website mentioned in notes).

In the first week you will use a procedure to genetically transform bacteria with the gene that codes for Green Fluorescent Protein. Following the transformation procedure, the bacteria express their newly acquired jellyfish gene and produce the fluorescent protein, which causes them to glow a brilliant green color under ultraviolet light. During the second week you will purify the protein away from all of the other proteins produced by the bacteria using chromatography, and during the third week you will evaluate the success of the purification procedure and estimate the size (molecular weight) of GFP by using sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE).

Fundamental to the process of genetic transformation of bacteria are plasmids. In addition to one large chromosome, bacteria naturally contain one or more small circular pieces of DNA called plasmids. Plasmid DNA usually contains genes for one or more traits that may be beneficial to bacterial survival. In nature, bacteria can transfer plasmids back and forth allowing them to share these beneficial genes. This natural mechanism allows bacteria to adapt to new environments. The occurrence of bacterial resistance to antibiotics is due in large part to the transmission of plasmids which contain antibiotic resistance genes.

The pGLO plasmid (Fig. 5, not a naturally occurring plasmid) contains the gene for GFP, and also contains the gene for the enzyme β-lactamase (bla), which provides resistance to the antibiotic ampicillin. The β-lactamase protein is produced and secreted by bacteria that contain the plasmid. β-Lactamase inactivates the ampicillin present in the LB nutrient agar, allowing bacterial growth. Only transformed bacteria that contain the plasmid and express β-lactamase can survive on plates that contain ampicillin. Only a very small percentage of the cells take up the plasmid DNA and are transformed. Untransformed cells cannot grow on the ampicillin selection plates. pGLO also incorporates a special gene regulation system, which can be used to control expression of the fluorescent protein in transformed cells. The gene for GFP can be switched on in transformed cells by adding the sugar arabinose to the cells’ nutrient medium. Selection for cells that have been transformed with pGLO DNA is accomplished by growth on antibiotic plates. Transformed cells will appear white (wild-type phenotype) on plates not containing arabinose, and fluorescent green when arabinose is included in the nutrient agar medium.

for the first week section of lab

To each of two microfuge tubes, add 250ul of transformation buffer. Keep these tubes on ice.

Using a sterile loop, pick one colony of bacteria from the LB plate.

Transfer this colony to one of the microfuge tubes. Gently vortex the tube until the colony is dispersed. Repeat for the second tube.

Add 0.08ug of DNA to one of these tubes (+DNA tube).

Incubate both tubes on ice for 10 minutes.

Incubate both tubes at 42°C for 50 seconds.

Incubate both tubes on ice for 2 minutes.

Add 250ul of LB broth to each tube and incubate at room temperature for 10 minutes.

Flick each tube gently. Add 100ul of this transformation mix to the appropriate plates.

Results:

+DNA: LB/amp--> 1 colony, Glow: uncertain

+DNA: LB/amp/ara--> 9 colonies, Glow: yes

-DNA: LB/amp--> 7 colonies, GLow: no

-DNA: LB--> many colonies, Glow: no