🏷️ LIMITED TIME OFFER: GET 20% OFF GRADE+ YEARLY SUBSCRIPTION →
Log in
Biology
1
answer
0
watching
68
views

1. Outline the cycle of GTP binding and hydrolysis experiencedby the elongation factors EF-Tu and EF-G, describing how theproperties of each factor change depending on which form of guaninenucleotide is bound. What molecular interactions, or interventionby enzymatic regulators, influence the progression of each of thefactors through the cycle?

Watch
1
answer
0
watching
68
views

For unlimited access to Homework Help, a Homework+ subscription is required.

Trinidad Tremblay
Trinidad TremblayLv2
28 Sep 2019

Unlock all answers

Get 1 free homework help answer.
Already have an account? Log in
Share

Related textbook solutions

Molecular Cell Biology
8 Edition,
Lodish
ISBN: 9781464183393
Biology: Science for Life with Physiology
6 Edition,
Belk
ISBN: 9780134555430
Concepts of Biology
OER Edition,
Openstax
ISBN: 9781938168116
Biology
2nd Edition, 2013
Openstax
ISBN: 9781947172517
Essentials of Biology
5 Edition,
Mader
ISBN: 9781259660269

Related questions

You have discovered a new gene “X” that appears to be regulated by 3 transcription factors (E2F, SP-1 and C/EBPa). Another gene “Y” appears to also be regulated by these same proteins. Both genes are involved in cell cycle initiation but gene Y is expressed later in the cell cycle than gene X.

The DNA sequence at the promoter region is GCGCCAATGTGCTGACAGTTAATTAGGGCTA

The known DNA consensus sequence for each Transcription Factor is:

E2F – GCCAATGTGCTGA

SP-1 – GCTGACAGTTAA

C/EBPa – ACAGTTAATTAGG

It is not known which protein(s) are binding to their respective DNA consensus sequences. It is possible for one protein to be interacting with one another and not directly to the DNA. It is also possible for a transcription factor to use all or only a majority of the DNA consensus sequence. Both scenarios are possible. Discuss in general how protein:DNA and potein:protein interactions occur at the molecular level. Propose an explanation for what you believe may be happening and then design a series of experiments that will investigate the regulation of Gene X and Gene Y. All proteins and gene sequences are known. You have a large well-funded lab.

1. Kinesin-1 motors can move long distances on microtubule tracks without dissociating. By contrast, myosin II motors in skeletal muscle take only one or a few steps before letting go. What is most likely the difference between these two motors that allow two different types of movement?

A. Differences in length of the stalk of each respective motor allow for differences in step size

B. Differences in ATP versus GTP hydrolysis alter the motor head movement along filaments

C. Actin filaments are smaller in diameter and have less space for movement

D. Binding affinity of the Kinesin-1 motor head to microtubules is high, whereas binding affinity of the myosin II motor head to actin filaments is low

E. Microtubules are larger in diameter and have more space for movement

2. Dynamic instability causes microtubules either to grow or to shrink rapidly. What is the most likely reason for a microtubule to undergo rapid growth?

A. GTP hydrolysis exceeds the rate of heterodimer addition

B. GTP hydrolysis of alpha tubulin causes an outward bend in the heterodimer conformation

C. A low concentration of tubulin heterodimers are in solution

D. Heterodimer addition exceeds the rate of GTP hydrolysis

E. Increased trafficking of microtubule motor proteins favors stability

3. There are no known motor proteins that move on intermediate filaments (IFs). What property of intermediate filaments would most likely explain the lack of motor proteins?

A. Tissue specific expression of IFs prevent a single type of motor protein to evolve over time

B. Lateral bundling of IFs prevent motor movement

C. IFs are less dynamic than microtubules and actin filaments

D. IFs are unpolarized

E. IFs do not bind a nucleotide

4. You discover a mutation that results in less rapid hydrolysis of GTP by the beta-tubulin subunit. What would most likely occur?

A. There would be no change in filament assembly

B. There would be enhanced instability of the microtubule

C. There would be enhanced stability of the microtubule

D. Microtubules would not form

E. There would be enhanced treadmilling

5. Which of the following statements describes common features of cadherins and integrins?

A. They can link to microtubules using specific adapter proteins

B. They mediate heterophillic interactions

C. They achieve high binding affinity through clustering

D. They are responsible for interactions of a cell with the extracellular matrix

E. They are found in the apical plasma membrane of an epithelial cell

6. Intermediate filaments are uniquely non-polar and built by lateral bundling in five steps: 1) synthesis of an alpha-helical monomer, 2) formation of a coiled-coil dimer, 3) formation of a staggered tetramer of two coiled-coil dimers, 4) lateral association of 8 tetramers, and 5) addition of 8 tetramers to a growing filament. At what step is polarity lost?

A. Step 1

B. Step 2

C. Step 3

D. Step 4

E. Step 5

7. Collagenase is an enzyme that breaks peptide bonds in collagen to help destroy extracellular structures. What would be the most likely reason to use collagenase in a cell biology laboratory?

A. Disrupt cadherin interaction with the extracellular matrix

B. Disrupt cell-cell contacts to passage cells in cell culture

C. Dissociate epithelial cells from the underlying basement membrane to separate tissues

D. All of the answers are likely uses for collagenase

E. Lyse cells to expose intracellular proteins and organelles

1. C6H12O6 + 6O2 Ã 6CO2 + 6H2O Glucose is being _____ to _____ and oxygen is being _____ to _____. a. oxidized; carbon dioxide; reduced; water b. oxidized; water; reduced; carbon dioxide Incorrect c. reduced; water; oxidized; carbon dioxide d. reduced; carbon dioxide; oxidized; water

2. Which of the following stages in the breakdown of the piece of toast you had for breakfast generates the most ATP? a. the citric acid cycle Incorrect b. glycolysis c. the digestion of starch to glucose d. oxidative phosphorylation

3. Which of the following is a catabolic pathway? a. gluconeogenesis b. production of starch Incorrect c. glycolysis d. production of glycogen

4. Per molecule, the oxidation of a fatty acid results in _____ energy storage than the oxidation of glucose. a. the same b. less Incorrect c. more d. None of the above; fatty acids cannot be oxidized.

5. Of the eight reactions in the citric acid cycle, how many are oxidation-reduction reactions? a. one b. two c. three d. four e. five

6. The process of glycolysis transfers the energy in sugar molecules into the stored energy of activated carriers such as ATP and NADH. Which statement is true about glycolysis? a. Only eukaryotic organisms do glycolysis. b. The ten reactions of glycolysis are identical in all eukaryotic cells, but are different in prokaryotic cells due to their diverse metabolic strategies. Incorrect c. The ten reactions of glycolysis are identical in almost all living organisms on the planet. d. There are many ways to oxidize glucose and transfer energy into activated carriers; the diversity of organisms on the planet is reflected in the diversity of their mechanisms of glycolysis.

7. Referring to the sentence completed in #13 above, the purpose of the latter reaction (in active muscle cells) is to _____. a. accumulate lactic acid in the cell, which provides additional energy for the production of ATP Incorrect b. slow down glycolysis until oxygen becomes available again c. accelerate the Krebs cycle, which will restore the oxygen supply d. regenerate NAD+ so that glycolysis can continue in the absence of oxygen

8. What are the products of the citric acid cycle? a. carbon dioxide, NADH, FADH2 and GTP b. carbon dioxide, NAD+, FAD and GTP c. NADH, FADH2, and acetyl CoA Incorrect d. carbon dioxide and water

9. Which statement is true about enzymes? a. Enzymes catalyze chemical reactions because they make inherently endergonic reactions exergonic. b. Each enzyme in a cell can catalyze many different chemical reactions involving chemically different substrates. Incorrect c. Enzymes can only catalyze reactions in one direction. d. After catalyzing a reaction, an enzyme is permanently altered and can no longer bind substrate. e. None of the above is true. 1

10. ∆G measures the change in free energy in a system as it converts reactant (Y) into product (X). When [X] = [Y], ∆G is equal to _____. a. RT b. ΔG° + RT c. ΔG° d. ln [X]/[Y]

11. The ∆G° for the hydrolysis of ATP is -7.3 kcal/mol. What conditions in the cell would lead to a ∆G for ATP hydrolysis of -11 kcal/mol? a. An increase in the ATP/ADP ratio b. An increase in anabolic activity in the cell c. Transport of ATP out of the compartment where the reaction is occurring Incorrect d. A decrease in the ATP/ADP ratio

12. In the first reaction of glycolysis, a phosphate transferred from ATP to a glucose molecule to produce glucose-6-phosphate and ADP. Under conditions existing in the cell, the free energy change for this reaction is -8.0 kcal/mole. Which of the following statements is true? Recall that the ∆G° for the hydrolysis of ATP is -7.3 kcal/mol. a. Glucose concentrations in the cell are always low, making this reaction more favorable than would be expected. b. This reaction is less favorable than would be expected, given the ∆G° of ATP hydrolysis. c. Glucose-6-P concentrations in the cell are very low relative to glucose concentrations, making the reaction more favorable than would be expected. d. The ∆G° for the addition of a phosphate to glucose must be -0.7 kcal/mole.

13. Protein E can bind to two different proteins, S and I. The binding reactions are described by the following equations and values: E + S --> ES Keq for ES = 10 E + I> EI Keq for EI = 2 Given the equilibrium constant values, which one of the following statements is true? a. When S is present in excess, no I molecules will bind to E. b. E binds I more tightly than S. c. The binding energy of the ES interaction is greater than that of the EI interaction. d. Changing an amino acid on the binding surface of I from a basic amino acid to an acidic one will probably make the free energy of association with E more negative.

Weekly leaderboard

Home
Homework Help 3,900,000
Biology 460,000
Start filling in the gaps now
Log in