answers

watching

views

25 Jan 2018

Attempt this question only if you can give complete explanation to your choice. This is biology/genetics question

If an mRNA contains a protein-Ââcoding sequence that has 33 codons (including the start and stop codons), how many amino acids will be in the protein that is produced from translation of that mRNA?

a. 99

b. 32

c. 33

d. 11

e. 0

answers

watching

180

views

For unlimited access to Homework Help, a Homework+ subscription is required.

You have 0 free answers left.
Get unlimited access to 3.8 million step-by-step answers.

Get unlimited access

Already have an account? Log in

linaa23Lv10

17 Sep 2023

Unlock all answers

Get 1 free homework help answer.

Already have an account? Log in

You have 0 free answers left.
Get unlimited access to 3.8 million step-by-step answers.

Get unlimited access

Already have an account? Log in

Nelly StrackeLv2

26 Jan 2018

Already have an account? Log in

Related questions

Unit 2: Genetics Assignment

In this assignment you will convert a DNA sequence into proteins through several steps. If you have no idea where to begin I recommend that you watch the âHow to read the Genetic Codeâ and âProtein Synthesisâ videos

Here is the DNA sequence:

TACCACGCCAAGCGAAGCGGGATT

Part 1: Transcribe the sequence into mRNA and separate the mRNA into codons. Name the enzyme responsible and the start and stop codons used.

Part 2: Give the tRNA anticodons that match the mRNA.

Part 3: Translate the mRNA into amino acids.

Part 4: Give an example of how a mutation to this sequence could cause a silent mutation.

Hereâs an example that you can complete:

Normal DNA = CAC Mutated DNA = CAG

Normal mRNA = Mutated mRNA=

Normal amino acid = Mutated amino acid=

*What do you notice happened above?

*What does this tell you about the effect of a silent mutation?

Part 5: Give an example of how a mutation to this sequence could cause a missense mutation.

Hereâs an example that you can complete:

Normal DNA = CAC Mutated DNA = GAC

Normal mRNA = Mutated mRNA=

Normal amino acid = Mutated amino acid=

*What do you notice happened above?

*What does this tell you about the effect of a missense mutation?

Part 6: Besides mutations how else do bacteria acquire new genes? Define each of these in your own words:

*transformation

*transduction

*conjugation

salmonrabbit236

Given the following sequence of the coding strand, written in standard 5' to 3' orientation, locate the start codon.

CGTTATGTTATGGACTCTCTGGTATGACTCACCT

Starting with and including the start codon, you should have determined the sequence of the protein that would be produced by this in the previous question. What percentage of amino acids in this sequence is coded by a "rare" amino acid â i.e., and amino acid with is encoded by <4 codons? (Enter an integer number between 0 and 100, rounding up if necessary).

-----

Could somebody explain in greater detail what a "rare" amino acid is and possibly provide a link to a table? I know the start codon is ATG, but believe the i.e. section of this question is miswritten. Do they mean an amino acid chain that is composed of less than 4 codons, or is there something I'm missing? Any assistance would be appreciated.

Fill in the blank. Elongation during translation does NOT involve ____________.

Question 16 options:

	the translation of codons according to the genetic code
	the formation of bonds catalyzed by the ribosome
	complementary base pairing between RNA molecules
	amino acids being linked together in a polypeptide
	reading the DNA template 3' to 5'

For a given gene, what establishes the reading frame for translation?

Question 17 options:

	the location of the enhancer relative to the gene
	the first three nucleotides at the 5' end of the mRNA
	the first three nucleotides at the 3' end of the mRNA
	the start codon in the mRNA
	the location of the promoter relative to the gene

Which of the following is the LEAST likely direct consequence of a substitution mutation?

Question 18 options:

	changing the length of a protein coded for by a gene
	changing one amino acid in a protein
	creating a stop codon
	eliminating a start codon
	changing the length of the DNA molecule containing a gene

Suppose that the pre-mRNA transcript from a eukaryotic gene is 30,000 nucleotides long, and the gene codes for a sequence of 300 amino acids. What is the best explanation for the relationship between these numbers?

Question 19 options:

	only the first 900 nucleotides of the pre-mRNA transcript are translated
	it takes 100 nucleotides to specify a single amino acid
	300 of the nucleotides in the transcript are important, and the rest are "junk"
	only the last 900 nucleotides of the pre-mRNA transcript are translated
	large portions of pre-mRNA transcripts are cut out during RNA processing

Suppose an individual is born into a population with a novel mutation. Is the new mutation an evolutionary change, and why?

Question 20 options:

	no, because it is not a big enough change to count
	yes, because new mutations are always adaptive
	yes, because the appearance of a new genetic variant is a genetic change in a population
	no, because not enough individuals have the mutation for it to matter
	no, because most mutations are not adaptive