A research group has sequenced the cDNA and genomic DNA from a particular gene. The cDNA is derived from mRNA, so it does not contain introns. Here are the DNA sequences. cDNA: 5Í´âATTGCATCCAGCGTATACTATCTCGGGCCCAATTAAT - GCCAGCGGCCAGACTATCACCCAACTCGGTTACCTACTAG - TATATCCCATATACTAGCATATATTTTACCCATAATTTGTGTGT - GGGTATACAGTATAATCATATAâ3Í´ Genomic DNA (contains one intron): 5Í´-ATTGCATCCAGCGTATACTATCTCGGGCCCAAT - TAATGCCAGCGGCCAGACTATCACCCAACTCG - GCCCACCCCCCAGGTTTACACAGTCATACCATACA TACAAAAATCGCAGTTACTTATCCCAAAAAAACCTAG - ATACCCCACATACTATTAACTCTTTCTTTCTAGGTTACCTAC - TAGTATATCCCATATACTAGCATATATTTTACCCATAATTTGT - GTGTGGGTATACAGTATAATCATATAâ3Í´ Indicate where the intron is located. Does the intron contain the normal consensus splice site sequences based on those described in Figure 14.19? Underline the splice site sequences, and indicate whether or not they fit the consensus sequence.
A research group has sequenced the cDNA and genomic DNA from a particular gene. The cDNA is derived from mRNA, so it does not contain introns. Here are the DNA sequences. cDNA: 5Í´âATTGCATCCAGCGTATACTATCTCGGGCCCAATTAAT - GCCAGCGGCCAGACTATCACCCAACTCGGTTACCTACTAG - TATATCCCATATACTAGCATATATTTTACCCATAATTTGTGTGT - GGGTATACAGTATAATCATATAâ3Í´ Genomic DNA (contains one intron): 5Í´-ATTGCATCCAGCGTATACTATCTCGGGCCCAAT - TAATGCCAGCGGCCAGACTATCACCCAACTCG - GCCCACCCCCCAGGTTTACACAGTCATACCATACA TACAAAAATCGCAGTTACTTATCCCAAAAAAACCTAG - ATACCCCACATACTATTAACTCTTTCTTTCTAGGTTACCTAC - TAGTATATCCCATATACTAGCATATATTTTACCCATAATTTGT - GTGTGGGTATACAGTATAATCATATAâ3Í´ Indicate where the intron is located. Does the intron contain the normal consensus splice site sequences based on those described in Figure 14.19? Underline the splice site sequences, and indicate whether or not they fit the consensus sequence.