1
answer
0
watching
35
views
28 Sep 2019
30. Which TWO modifications of heterogenous nuclear RNA is important for the stability of the transcription and for its translation?
31. Below is a sequence of a heterogenous nuclear RNA with exons shaded grey and nucleotides that are important for splicing indicated in bold.
...cacccggctcccgcttcacctggggcacagtgcaggtggtcacaggccaagcgggcacgcccactgtgccccccgaccccagcccacagg
ctcctgtccctgcccactcagcttcaaggcctâ¦
Which cis-acting elements come into close proximity to form the lariat during splicing?
Extra credit: What is the protein that is translated from the mRNA indicated in questions 25 and 26 and what is its general function (hint: you will need to use one of the algorithms found on the NCBI website)?
30. Which TWO modifications of heterogenous nuclear RNA is important for the stability of the transcription and for its translation?
31. Below is a sequence of a heterogenous nuclear RNA with exons shaded grey and nucleotides that are important for splicing indicated in bold.
...cacccggctcccgcttcacctggggcacagtgcaggtggtcacaggccaagcgggcacgcccactgtgccccccgaccccagcccacagg
ctcctgtccctgcccactcagcttcaaggcctâ¦
Which cis-acting elements come into close proximity to form the lariat during splicing?
Extra credit: What is the protein that is translated from the mRNA indicated in questions 25 and 26 and what is its general function (hint: you will need to use one of the algorithms found on the NCBI website)?
Jarrod RobelLv2
28 Sep 2019
