4. Microsatellites are repeating sequences of 2-6 base pairs ofDNA. KAH is a hypothetical human microsatellite locus with arepeating sequence of CAGA. The locus is shown in the figure with20 bp of flanking DNA sequences that can serve as primers foramplification of the locus by PCR.
5â GTTACTTAGGTATTGCCGAT KAH ATCTTGTAACCTAT ACTGTG3â
3â CAATGAATCCATAACGGCTA LOCUSTAGAACATTGGATATGACAC 5â
a. You will use PCR to genotype individuals for the KAH locus.The primers should be 20 nucleotides long. Determine the sequencesfor the two primers required to amplify the KAH locus. Note thatyou must label the 5â and 3â ends of both primers. Also, primersequences, by designation, are always written in the 5â to 3âdirection. 1 pt
b. Assume two KAH alleles, one with 8 and another with 5 copiesof the repeating unit. Using the primers you have designed, whatwill be the sizes of the amplified PCR products for each allele? 1pt
c. There are actually four known alleles of the KAH locus with13, 10, 8, and 5 copies of the repeating unit. How many possiblegenotypes are there for these alleles, and what are they? 1 pt
d. One parent is heterozygous for the 13 and 8 alleles of theKAH locus and the other parent is heterozygous for the 8 and 5alleles. The two parents live with three children. When youdetermine the genotype of the two children, the two genotypes are(8, 5) and (13, 10). What can you conclude about the parentage ofthe two children? 1 pt
4. Microsatellites are repeating sequences of 2-6 base pairs ofDNA. KAH is a hypothetical human microsatellite locus with arepeating sequence of CAGA. The locus is shown in the figure with20 bp of flanking DNA sequences that can serve as primers foramplification of the locus by PCR.
5â GTTACTTAGGTATTGCCGAT KAH ATCTTGTAACCTAT ACTGTG3â
3â CAATGAATCCATAACGGCTA LOCUSTAGAACATTGGATATGACAC 5â
a. You will use PCR to genotype individuals for the KAH locus.The primers should be 20 nucleotides long. Determine the sequencesfor the two primers required to amplify the KAH locus. Note thatyou must label the 5â and 3â ends of both primers. Also, primersequences, by designation, are always written in the 5â to 3âdirection. 1 pt
b. Assume two KAH alleles, one with 8 and another with 5 copiesof the repeating unit. Using the primers you have designed, whatwill be the sizes of the amplified PCR products for each allele? 1pt
c. There are actually four known alleles of the KAH locus with13, 10, 8, and 5 copies of the repeating unit. How many possiblegenotypes are there for these alleles, and what are they? 1 pt
d. One parent is heterozygous for the 13 and 8 alleles of theKAH locus and the other parent is heterozygous for the 8 and 5alleles. The two parents live with three children. When youdetermine the genotype of the two children, the two genotypes are(8, 5) and (13, 10). What can you conclude about the parentage ofthe two children? 1 pt
