Log in
Biology
1
answer
0
watching
122
views

Can someone please help me with this problem? I am havingtrouble with figuring it out. Thank you in advanced! The 10xobjective has a numerical aperture of 0.25. What would be thesmallest distance (in μm) between two objects that can be resolvedwhen using that objective with light at 400 nm?

Watch
1
answer
0
watching
122
views

For unlimited access to Homework Help, a Homework+ subscription is required.

Collen Von
Collen VonLv2
30 Sep 2019

Unlock all answers

Get 1 free homework help answer.
Already have an account? Log in
Share

Related textbook solutions

Molecular Cell Biology
8 Edition,
Lodish
ISBN: 9781464183393
Biology: Science for Life with Physiology
6 Edition,
Belk
ISBN: 9780134555430
Biology
2nd Edition, 2013
Openstax
ISBN: 9781947172517
Concepts of Biology
OER Edition,
Openstax
ISBN: 9781938168116
Essentials of Biology
5 Edition,
Mader
ISBN: 9781259660269

Related questions

(1) A 1/10 serial dilution of a bacterial culture was performed in tubes "A" through "E" (dilutions were made in that order beginning with tube "A" like in the handout slide titled "Spread Plating"). 100 microliters of the diluted culture from the final tube "E" was spread onto a plate. Following incubation of the plate, growth of the bacteria produced 65 colonies on that plate. What is the concentration of viable cells in tube "B" (in cells per milliliter)? (2 pts)

(2) Penicillin is an antibiotic that inhibits an enzyme located in the cytoplasmic membrane (the enzyme is required to synthesize peptidoglycan). In general, explain why Gram-positive bacteria are sensitive to penicillin and Gram-negative bacteria are not? (2 pts)

(3) The 40x objective has a numerical aperture of 0.65. What would be the smallest distance (in μm) between two objects that can be resolved when using that objective with light at 470 nm? (2 pts)

I am very confused on how to start this problem, can someone please explain and help me out! thank You!

Background:

Apolipoprotein L1 (APOL1) gene is expressed in humans and some non-human primates. Variations in APOL1 gene are implicated in the development of a severe, progressive kidney disease called focal and segmental glomerulosclerosis (FSGS). An interesting observation about APOL1 is that its pathologic (FSGS-associated variant) is more common in groups in western Africa. Researchers have discovered that this variant causes protection against a trypanosome that causes sleeping sickness. Unfortunately, the molecular mechanisms of APOL1 and its role in FSGS development are poorly understood, but it is a hot topic of debate in the medical research community in the USA, because it is associated with a large number of patients, generally of west African ancestry, who develop FSGS during their lifetimes. APOL1 variants are also implicated in kidney transplant failure.

The problem:

You are part of a team focused on understanding and developing a cure for APOL1-variant associated kidney disease.

Your long-term goal is to identify:

1) How APOL1 confers immunity to trypanosomal illness

2) How APOL1 variants may alter kidney (renal) physiology

3) Tools to genetically modify APOL1 in patients allelic variants (either heterozygous or homozygous) to prevent development of FSGS.

About Gene Cloning - EMERGENCY :(!!

Hello I have to write a report about the experiment I did aboutgene cloning and also have to answer few qns from the prof. I woudreally appreciate if anybody can help me and will thank you in apossible way. I am that desperate since this would be veryimportant for my grade :(

I don't know the insert gene and have to figure it out on NCBIBLAST search using the sequence.( I tried but I couldnt find onNCBI)

The cloning was with pGEX-4T-1 vector and unknown gene which isabout 700bp.

It says by using pGEX_3_primer, got the sequence, which would bereverse sequnece so I did reverse and it is

AAAATTAGTTTGTTTTAAAAAACGTATTGAAGCTATCCCACAAATTGATAAGTACTTGAAATCCAGCAAGTATATAGCA

TGGCCTTTGCAGGGCTGGCAAGCCACGTTTGGTGGTGGCGACCATCCTCCAAAATCGGATCTGGTTCCGCGTGG

ATCCACCGGTCGCCACCATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCA

AGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGA

GGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTC

AGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCG

AGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCT

GCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAA

GAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAG

CAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGT

GCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAA

CAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTAGCGGCCGC

Then the qn is,

1.What is this gene? Where is the start and stop codon of thisgene coding sequence?

2.Would this gene translated in in-frame? Gst fusion?

3.What is the partial expected amino acid sequence of GST-YFPprotien?

4.Can you find the restriction enzyme site that we used? (BamHI,NotI)

5.To check weather the cloning was done or not, it is better touse one restriction enzyme that is on vector and the other is oninsert. In this case we used the same emzyme as we used for cloningwhich are BamHI and NotI. If we want to still use NotI but changeBamHI as different enzyme, what could it be?

Weekly leaderboard

Home
Homework Help 3,900,000
Biology 460,000
Start filling in the gaps now
Log in