27."The"crystal"structure"of"your"protein"reveals"a"central"β!sheet."Which"of"the"
following"statements"about"β!sheets"is"TRUE?"
a.""Amino"acid"side"chains"in"β!sheets"all"extend"out"on"one"side"of"the"β!sheet."
b.""β!sheets"have"a"straight"edge on"appearance."
c.""β!sheets"are"composed"of"β strands"running"in"only"an"antiparallel"direction."
d."Two"adjacent"β strands"in"a"β!sheet"will"fulfill"all"of"the"possible"hydrogen"bonds"
between"their"peptide"back"bone"atoms."
e.""None"of"the"above"statements"are"true."
27."The"crystal"structure"of"your"protein"reveals"a"central"β!sheet."Which"of"the"
following"statements"about"β!sheets"is"TRUE?"
a.""Amino"acid"side"chains"in"β!sheets"all"extend"out"on"one"side"of"the"β!sheet."
b.""β!sheets"have"a"straight"edge on"appearance."
c.""β!sheets"are"composed"of"β strands"running"in"only"an"antiparallel"direction."
d."Two"adjacent"β strands"in"a"β!sheet"will"fulfill"all"of"the"possible"hydrogen"bonds"
between"their"peptide"back"bone"atoms."
e.""None"of"the"above"statements"are"true."
For unlimited access to Homework Help, a Homework+ subscription is required.
Related textbook solutions
Related questions
Question 4
Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)
Guanine histone Double helix Adenine conservative cytosine | Okazaki fragments Thymine introns Leading strand RNA polymerase 5-prime to 3-prime | Uracil chromatin DNA ligase Semi-conservative promoter | Lagging strand DNA polymerase nucleosomes Electron transport chain enhancer |
Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.
Question 5
In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."
Lactose | Glucose | Lac expression? |
No | Yes | |
Yes | Yes | |
Yes | No |
Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.
Question 6
Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)
a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:
5âAUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3â
b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.
c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?
Question 401 pts
Kinetic energy is the stored energy that can be used for motion.
True |
False |
Flag this Question
Question 411 pts
When an electron is transferred from one atom to another, and the two atoms are then electrically attracted to one another, a(n) ________________ bond is formed.
ionic |
kinetic |
covalent |
hydrogen |
Flag this Question
Question 421 pts
Changing the number of ____________ of an atom would change the chemical properties of the atom.
neutrons |
protons |
electrons |
electron shells |
Flag this Question
Question 431 pts
Forming molecules and breaking down molecules in biological organisms usually requires the use of _________ to help the reaction proceed faster.
oil |
heat |
enzymes |
blood |
Flag this Question
Question 441 pts
Organic molecules have a core composed of .
carbon |
nitrogen |
phosphorus |
hydrogen |
Flag this Question
Question 451 pts
The building blocks of carbohydrates are
polypeptides |
amino acids |
nucleotides |
monosaccharides |
Flag this Question
Question 461 pts
Water molecules crossing a membrane from high to low concentration is .
active transport |
cell fate |
facilitated diffusion |
osmosis |
Flag this Question
Question 471 pts
Choose the membrane molecule responsible for the passage of polar molecules and ions into and out of the cell.
phospholipids |
transmembrane channel proteins |
cell surface proteins |
carbohydrate chains |
Flag this Question
Question 481 pts
The simplest cells are .
prokaryotic |
animal cells |
eukaryotic |
cells of fungi |
Flag this Question
Question 491 pts
Which of the following membrane bound organelles are found inside bacterial cells:
nucleus |
organelles are not found in prokaryotic cells |
mitochondria |
chloroplasts |
Flag this Question
Question 501 pts
Which of the following is a specialized components of the cell, is associated with the rough endoplasmic reticulum, and is responsible for making proteins.
vacuoles |
ribosomes |
golgi complex |
nucleus |
Flag this Question
Question 511 pts
Proteins are sorted, modified, and packaged by the _____________ and later transported to the outside of the cell.
ribosomes |
golgi bodies (golgi apparatus) |
nucleus |
mitochondria |
Flag this Question
Question 521 pts
Dehydration synthesis is a process of linking two smaller subunits together to form a polymer. Which of the following statements below is true of dehydration synthesis?
Oxygen is consumed. |
A water molecule is removed from the molecules. |
A water molecule is added to the molecules |
Carbon dioxide is given off. |
Flag this Question
Question 531 pts
Proteins are made up of _________ held together by peptide bonds.
monomers |
monosaccharides |
polymers |
amino acids |
Flag this Question
Question 541 pts
Which of the following gives an amino acid its properties?
NH2 |
R Group or functional group |
COOH |
H |
Flag this Question
Question 551 pts
The final three-dimensional shape of a protein that includes the bonding of two or more polypeptide chains is call its _____ structure.
Tertiary |
Quaternary |
Secondary |
Primary |
Flag this Question
Question 561 pts
How do DNA and RNA differ?
all statements are differences between DNA and RNA. |
DNA is double stranded while RNA is single stranded. |
They have different sugars. |
Thymine is present in DNA but not in RNA. |
Flag this Question
Question 571 pts
Which of the following is a component of a DNA nucleotide?
phosphate |
a nitrogen containing base |
All are components of a nucleotide. |
5-carbon sugar |
Flag this Question
Question 581 pts
Cell membranes are made up of several different types of molecules. Select the membrane molecule below that is made up of a polar region and two non-polar fatty acid tails.
transmembrane proteins |
carbohydrate chains |
phospholipids |
cell surface proteins |
Flag this Question
Question 591 pts
Two organelles which are believed to have once been free-living bacterial cells are ____________ and ______________.
chloroplasts and mitochondria |
golgi apparatus and endoplasmic reticulum |
ribosomes and nucleolus |
peroxisomes and lysosomes |
Flag this Question
Question 601 pts
The is an extensive system of internal membranes responsible for producing carbohydrates and lipids.
smooth endoplasmic reticulum |
rough endoplasmic reticulum |
nucleolus |
mitochondria |