Question

Background info:

You have identified an organism with the smallest known genome (sequence below). You isolate the DNA and digest it with EcoR1

EcoRI --- 5' G ↓AATTC 3'

5' ACGACGTATTAGAATTCTTATCCGCCGCCGGAATTCTCATCA 3'

3’ TGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’

Look for palindromic site, specific for restriction enzyme, each strand of the DNA is “cut” (phosphodiester bond of backbone is cleaved) at the same place in the sequence, this will produce sticky ends

The key steps in the experiment:

1. Extract DNA from organism (how would you do this, can you separate protein and nucleic acids, what about DNA from RNA)

2. Incubate DNA with restriction enzyme (what is you used the wrong enzyme? What if you accidentally boiled your sample?

3. Use gel electrophoresis to separate out DNA fragments by size (need a gel, need an electrical current, buffer)

4. Use Ethidium Bromide (EtBr) either in the gel or as a stain afterwards (this will allow for visualization of the DNA, non-specific, ring structure intercalates with bases, excited by UV light, emits orange light)

5. Include a ladder/controls – (you need ladder or something of known size if you want to estimate the size of the fragments)

6. Visualize with UV light source and imager

7. Important – maybe not as key - Use loading dye when loading DNA buffer (the buffer helps the DNA settle into the well, dye lets you approximate where the DNA should be in the gel as it is running)

______________________________________________________________________________________

Here is the question I would like to know:

1) What would happen if we changed something in the experiment?

A) What would happen if we changed step 1?

b) What would happen if we changed step 2?

c) What would happen if we changed step 3?

d) What would happen if we changed step 4?
e) What would happen if we changed step 5?

f) What would happen if we changed step 6?

g) What would happen if we changed step 7 (if anything) ?