answer

watching

views

16 Oct 2018

1. Genes are segments of _ that code for synthesis.=

a. chromosomes; proteins b. chromosomes; DNA

c. genes; polysaccharide

d. chromosomes; amino acids

2. What percentage of cancers are estimated to result from mutations that are not inherited?

a. less than 1%

b. 20 %

c. 5%

d. 70%

3. Which of the following does not contain condensed chromosomes that have been duplicated?

a. a cell during the G1 phase of interphase

b. a cell during prophase

c. a cell during metaphase

d. a cell immediately preceding anaphase

4. Which of the following is a good example of an allele?

a. a segment if DNA that codes for brown eye color

b. a section of DNA that determines eye color

c. a sex chromosome that determines whether you are male or female

d. a DNA sequence that produces a protein

5. Whereas cloning is commonly used in studies of bacteria, Dolly the sheep was the only animal ever cloned.

a. True b. False

answer

watching

109

views

For unlimited access to Homework Help, a Homework+ subscription is required.

You have 0 free answers left.
Get unlimited access to 3.8 million step-by-step answers.

Get unlimited access

Already have an account? Log in

Irving HeathcoteLv2

17 Oct 2018

Unlock all answers

Get 1 free homework help answer.

Already have an account? Log in

Related questions

Part A:

In prokaryotes and eukaryotes cell reproduction is similar in that it requires some kind of signal to proceed, DNA replication, careful separation of the DNA into two equal portions, and division of the cytoplasm. How is cell reproduction different in prokaryotes and eukaryotes?

Select one:

a. In a eukaryotic organism, the signals for cell division are usually not related to the environment but to the function of the entire organism.

b. Eukaryotic cells constantly divide whenever environmental conditions are adequate and the cells are large enough.

c. The linear chromosomes in prokaryotes are constantly being updated.

d. Prokaryotic cell division requires cytokinesis before mitosis because of their small size.

e. The sexual phase of most prokaryotes (bacteria) is essential to the rapid cell division required for infection.

Part B:

What does the name Cyclin Dependent Kinase stand for?

Select one:

a. A protein important to the cell cycle that is dependent on DNA synthesis.

b. An enzyme that cuts DNA so that chromosomes can segregate.

c. An enzyme that phosphorylates other proteins using ATP only when the protein Cyclin is bound to the enzyme.

d. An enzyme that rolls along microtubules dragging a vesicle.

e. An enzyme that connects chromosomes to the spindle fiber.

Part C:

The Cell Cycle is divided into Mitosis, Cytokinesis, and Interphase. Mitosis can be ordered into the following phases:

Select one:

a. Prophase/Prometaphase/Metaphase/Anaphase/Telophase

b. Anaphase/Prometaphase/Metaphase/Prophase/Telophase

c. Metaphase/Anaphase/Telophase/Prophase/Prometaphase

d. Telophase/Prophase/Prometaphase/Metaphase/Anaphase

e. Anaphase/Telophase/Prophase/Prometaphase/Metaphase

Part D:

The Cell Cycle is divided into Mitosis, Cytokinesis, and Interphase. Interphase can be ordered into the following phases:

Select one:

a. S/G1/G2

b. G2/G1/S

c. G1/S/G2

d. G2/S/G1

e. G1/G2/S

amethystyak657

Match the term with its correct definition or explanation.

Chromatin

Homologous Chromosomes

Sister chromatids

Diploid

Interphase

S Phase

Synapsis

Crossing Over

Cell Plate

Cleavage Furrow

A. The exchange of genetic material between homologous chromosomes during meiosis I.

B. The pairing or tight association of homologous chromosomes in meiosis I. Results in the formation of a tetrad.

C. Non-identical copies of the same chromosome. Present in all diploid cells, even before replication. These chromosomes are the same length and contain genes for the same characteristics, but may have different alleles for each gene. D.

The period of the cell cycle that includes G1, S phase, and G2. E. A structure that develops during cytokinesis in plants.

F. Condensed chromosomes.

G. An invagination that develops during cytokinesis in animal cells.

H. When an organism has two copies of every chromosome (2n).

I. Two identical copies of a chromosome. These are only present after DNA replication.

J. The phase of the cell cycle when DNA is replicated.

PLEASE answer ALL THE QUESTIONS. DO NOT ANSWER IF YOU CANT ANSWER ALL OF IT.

3'- GGCCTTAAGCATGCATGCAT -5'

5'- CCGGAATTC(G)TACGTACGTA -3'

1. If a replication fork is moving from right to left along this DNA structure, which strand is the lagging strand template?

a) not enough information is provided

b) top strand

2. Which of the following occurs during Metaphase I of meiotic cell division?

a) Tetrads composed of homologous chromosomes line up at the center of the cell

b) homologous chromosomes separate

c) sister chromatid pairs line up at the center of the cell

d) non-sister chromatids exchange regions of DNA

3. A gerbil is a diploid organism with 58 chromosomes. Which of the following is true?

a) a gerbil cell in G2 phase has 58 chromosomes and 116 sister chromatids

b) a gerbil cell in Prophase has 58 chromosomes and 58 sister chromatid

c) a gerbil cell in Metaphase has 58 chromosomes and 58 sister chromatid

4. At the end of elongation and during the termination of replication on the leading strand, place the following events in the correct chronological order.

I. DNA pol I synthesizes DNA

II. DNA ligase seals the nicks in the daughter DNA

III. DNA pol I removes the RNA primers

IV. DNA pol III synthesizes DNA

a) IV-III-I-II

b)I-III-IV-II

c) III-I-II-IV

5. A gene for hair color (brown vs. blond) and a gene for finger length (long vs. short) are found on two different chromosomes. If a blond haired, long fingered mother is homozygous for hair color and homozygous for finger length, what is the probability that she passes along the preference for her son to have blond hair and long fingers?

a) 0%

v) 100%

c) 25%

6. For oxytocin signaling between two neurons, what is the correct order of events?

I. an oxytocin vessicle fuses with the plasma membrane

II. an oxytocin vessicle docks with plasma membrane

III. oxytocin molecules bind to the oxytocin receptor at the plasma membrane of the receiving neuron

IV. oxytocin molecules diffuse into the synapse

a) I-III-II-IV

b) II-I-IV-III

c) I-II-III-IV

7. The independent assortment of chromosomes is due to events that occur during ______.

a) meiosis I only

b) meiosis II only

c) mitosis and meiosis II

champagnemole592

Weekly leaderboard

Home

Homework Help 3,900,000

Biology 460,000

Unlock all answers

Related textbook solutions

Molecular Cell Biology

Biology: Science for Life with Physiology

Biology

Concepts of Biology

Essentials of Biology

Related questions

Related Documents

BIO 202 Lecture Notes - Lecture 22: Motor Protein, Cleavage Furrow, Prophase

BIO1022 Study Guide - Spindle Apparatus, Sister Chromatids, Cell Cycle

BIO1022 Study Guide - Spindle Apparatus, Sister Chromatids, Cell Cycle

Weekly leaderboard