MICROBIO 310 Lecture Notes - Lecture 6: Polysome, Chloramphenicol, Start Codon

27 views5 pages

scarletplatypus749

23 Mar 2016

School

Department

Course

Professor

For unlimited access to Class Notes, a Class+ subscription is required.

Document Summary

Functional unit of genetic information is the gene. Genes are in cells and are composed of dna. Three informational macromolecules in cell: dna, rna, protein (central dogma) Four nucleotides found in dna: adenine (a, guanine (g, cytosine (c, thymine (t) Backbone of dna chain is alternating phosphates and the pentose sugar deoxyribose. Phosphates connect 3"-carbon of one sugar to 5" carbon of the adjacent sugar. All cells and some viruses have dna in double stranded molecules. Two strands are antiparallel and form a double helix and have complementary base sequences: adenine always pairs with thymine, guanine always pairs with cytosine more stable double helix than a/t. Inverted repeats: repeated sequence that is arranged in an inverse orientation. Stem loops: short double helical regions caused by nearby inverted repeats. Hydrogen bonds between dna strands hold two strands together: the strands of dna that make the double helix are brought together by hydrogen bonding.

Related Questions

1. Unlike DNA, RNA contains

deoxyribose

a double strand

phosphates

uracil

Nucleic acid structure

2. In transcription, uracil will bond with:

thymine

cytosine

adenine

guanine

Transcription

3. The first team of scientist to document the structure of DNA was:

Franklin and Wilkins

Watson and Crick

Pauling and Chargoff

None of the above

DNA structure

4. Organelles that synthesize protein are:

lysosomes

ribosomes

endoplasmic reticulum

golgi bodies

5. Most of the time in a cell's life, it's DNA is in the form of:

Chromatin

Chromatids

Replicated chromosomes

Spindle fibers

6. Uracil is a nitrogen base that pairs with adenine. Using this information, one could conclude that uracil is a:

Purine

Pyrimidine

Neither a purine or pyrimidine

Not enough information

7. a nucleotide does not consist of a:

polymerase

5-carbon sugar

phosphate group

nitrogen base

8. The genetic code in DNA of an individual depends on the sequence (order) of:

nucleotides

purines only

phosphates

sugars

9. Before a cell divides, it must duplicate its DNA in a process known as:

translation

transformation

transcription

replication

10. The basic unit (building block) of a protein is a (an):

carbohydrate

amino acid

lipid

hydrogen bond

11. Unlike DNA, RNA contains:

deoxyribose

a double strand

phosphates

uracil

12. The structure of DNA was first documented in:

1945

1953

1956

1962

13. In DNA replication, the new molecules produced are:

of unequal length

both assembled in the same direction

built with purines as the backbone

assembled in opposite directions

DNA replication

14. The "backbone" of DNA is composed of:

ribose and phosphates

deoxyribose and phosphates

ribose and uracil

deoxyribose and thymine

DNA structure

15. RNA differs from DNA in which of the following ways?

RNA is single-stranded

RNA contains ribose

RNA does not contain thymine

All of the above

DNA structure

16. Which of the following is NOT required for the transcription process itself?

RNA polymerase

DNA

uracil-containing nucleotides

ribosomes

skyhamster121

1. _________________________ is the name of the process that produces proteins using RNA molecules.

a.Transcription

b Translation

c. Replication

d. Mutagenesis

2. The peptide bonding site on the ribosome:

a. A site

b. P site

c. E site

d. D site

3. The name given to the bond formed between two amino acids.

a. Hydrogen bond

b. Double bond

c. Peptide bond

d. Negative bond

4. __________________________ is the movement of the mRNA molecule on the ribosome to open up the A-site for the new incoming amino acid.

a. Transformation

b. Mutation

c. Translocation

d. Initiation

5. What does the term semi-conservative mean.

a. Replication of RNA is semi-conservative, each new strand consists of one old strand of RNA and one new strand of RNA.

b. Replication of DNA is semi-conservative, each new strand consists of one old strand of DNA and one new strand of DNA.

c. Replication of DNA is semi-conservative, each new strand consists of new strands of nucleotides.

d. Transcription of RNA is semi conservative.

6. This molecule functions during protein synthesis to recognize the codon and bring the proper amino acid back to the ribosome for translation.

a. mRNA

b. tRNA

c. rRNA

d. DNA polymerase

7. What is meant by the base-pairing rule.

a. Bases on a single strand of DNA are always found as pairs

b. Adenine always base pairs with guanine; cytosine with thymine

c. Adenine always base pairs with thymine; cytosine with guanine

d. Bases on a single strand of RNA are found in pair.

8. In this step of protein synthesis, amino acids are added to a growing polypeptide chain.

a. Initiation.

b. Elongation.

c. Termination.

d. Transpiration.

9. Three complementary bases found in a mRNA are called ____________________.

a. Anti-codon.

b. Triplet.

c. Doublet.

d. Codons.

10. Which statement best describes the job or function of the messenger RNA.

a. Carries the map of the gene sequence in the form of codons to the cytoplasm

for translation of the protein.

b. It transfers amino acids to the ribosome for protein synthesis.

c. It forms the ribosomes.

d. It helps replicate DNA.

ceruleangnat663

Question 4

Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)

Guanine

histone

Double helix

Adenine

conservative

cytosine

Okazaki fragments

Thymine

introns

Leading strand

RNA polymerase

5-prime to 3-prime

Uracil

chromatin

DNA ligase

Semi-conservative

promoter

Lagging strand

DNA polymerase

nucleosomes

Electron transport chain

enhancer

Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.

Question 5

In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."

Lactose	Glucose	Lac expression?
No	Yes
Yes	Yes
Yes	No

Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.

Question 6

Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)

a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5âAUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3â

b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.

c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

plumgoat220

MICROBIO 310 Lecture Notes - Lecture 6: Polysome, Chloramphenicol, Start Codon

Document Summary

Get access

Related Documents

MICROBIO 310 Lecture Notes - Lecture 7: Semiconservative Replication, Primase, Model Organism

MICROBIO 310 Lecture Notes - Lecture 8: Autolysin, Agar Plate, Rela

MBIO 2020 Lecture Notes - Lecture 1: Transfer Rna, Ribose, Peptide

Related Questions