7
answers
0
watching
42
views
11 Dec 2019

The uvrC gene encodes one of the proteins in E. coli nucleotide excision repair. When extracts of E. coli are incubated with the DNA fragment shown below, the mutation shown will be repaired. Note: The ‘T=T’ represents a thymine dimer, while the ‘A.A’ is the undamaged strand (the ‘.’ is just for proper spacing of the rest of the strand). 5'GTAACTATGATGGATAGACCGACAGGGGGACCAGTTG(T=T)GCGGGAGAGACCTTTAGATGAC3’ 3'CATTGATACTACCTATCTGGCTGTCCCCCTGGTCAAC(A.A)CGCCCTCTCTGGAAATCTACTG 5’

a. If an extract was used in which the uvrC protein could only cut the DNA on the 5’ side of the lesion, speculate on whether the DNA fragment could still be repaired.

b. If an extract was used in which the uvrC protein could only cut the DNA on the 3’ side of the lesion, speculate on whether the DNA fragment could still be repaired.

It is to my understanding that in the case of nucleotide excision repair that an uvrA uvrB complex identifies and isolates a problematic "bulky lesion". The complex recruits uvrC which cuts on either side of the damaged area approximately 5-8 nucleotides away. uvrD then is recruited to remove the cut strand. Given this question I assume that if you had a modified uvrC that could either only cut on the 5' or 3' end the segemnt including the damaged area could not be removed by uvrD in both cases meaning ultimately DNA polymerase/Ligase could not come in and fix things which means the segment could not be repaired. Am I correct in my thinking, or is there something I'm missing?

For unlimited access to Homework Help, a Homework+ subscription is required.

Unlock all answers

Get 1 free homework help answer.
Get unlimited access
Already have an account? Log in
Get unlimited access
Already have an account? Log in
Get unlimited access
Already have an account? Log in
Get unlimited access
Already have an account? Log in
Get unlimited access
Already have an account? Log in
Get unlimited access
Already have an account? Log in
Nestor Rutherford
Nestor RutherfordLv2
13 Dec 2019
Get unlimited access
Already have an account? Log in
Start filling in the gaps now
Log in