PCR Homework
Design a forward and a reverse primer ( 15 bases length ) to amplify the next DNA sequence
5âGGTGGTGCGCTTCCAAGAAGCAGCCAATAAGCAGAAGCAGGAACTCGACGAGATCTCGACGAATATTCGTCAGGCCGGCGTCCAATACTCGAGGGCCGACGAGGAGCAGCAGCAGGCGCTGTCCTCGCAAATGGGCTTCTGA3â
Name the reagents needed to do a PCR reaction
What is a DNA polymerase and why this enzyme from a thermoresistant microorganism must be used for the PCR?
The forward primer binds to the _____________ DNA chain and the ___________ primer bind to the main DNA chain that is the reason why we have to use the reverse _________ sequence to design the second primer
PCR Homework
Design a forward and a reverse primer ( 15 bases length ) to amplify the next DNA sequence
5âGGTGGTGCGCTTCCAAGAAGCAGCCAATAAGCAGAAGCAGGAACTCGACGAGATCTCGACGAATATTCGTCAGGCCGGCGTCCAATACTCGAGGGCCGACGAGGAGCAGCAGCAGGCGCTGTCCTCGCAAATGGGCTTCTGA3â
Name the reagents needed to do a PCR reaction
What is a DNA polymerase and why this enzyme from a thermoresistant microorganism must be used for the PCR?
The forward primer binds to the _____________ DNA chain and the ___________ primer bind to the main DNA chain that is the reason why we have to use the reverse _________ sequence to design the second primer
For unlimited access to Homework Help, a Homework+ subscription is required.
Related textbook solutions
Related questions
Please answer all
Why does a template-dependent DNA polymerase require a primer to initiate DNA synthesis?
DNA polymerase require 5' phosphate to add a new nucleotide | |
DNA polymerase require 3' hydroxyl group to add a new nucleotide |
DNA polymerase require energy by hydrolizing the primers |
Which of the following enzymes is template independent?
Reverse transcriptase | |
Klenow fragment |
DNA polymerase | |
Terminal deoxynucleotidyl transferase |
RNA polymerase |
The natural function of a DNA ligase enzyme is:
Joining together DNA sequences with compatible cohesive ends from two different organisms to yield a recombinant DNA molecule | |
Sealing single stranded nicks in double stranded DNA molecules |
Joining together two blunt ended fragments of DNA within a cell | |
Joining together two single stranded DNA molecules |
The natural function of 3' -> 5' exonuclease activity of a DNA polymerase is to:
Remove the 5' end of the DNA strand that is being copied | |
Remove damaged nucleotide from the template strand |
Remove nucleotides from the end of DNA to generate blunt ends | |
Remove incorrect nucleotides from the newly synthesized DNA |
Which technique is used to resolve the different sizes of DNA fragments?
Gene cloning | |
PCR |
DNA sequencing | |
Gel electrophoresis |
Which of the following vectors does not contain bacterial origin of replication (oriC)?
plasmid | |
cosmid |
bacterial artificial chromosome | |
lambda vector |
Which process of bacteriophage is not used for gene cloning?
Concatemer formation | |
Lytic cycle |
Lysogenic cycle | |
viral packaging |
What vector would be best suited for creating a contig of bovine (cattle) chromosome 10?
lambda vector | |
Cosmid vector |
P1 vector | |
Plasmid |
E. coli takes up plasmid DNA by which of the following methods?
Transduction | |
Transformation |
Conjugation | |
Transfection |
The following times and temperatures are an example of the steps for PCR. You can use the Figure to help you answer the following questions.
Why is the first step is carried out at 94°C?
To degrade the template | |
To denature the template |
To activate the polymerase | |
To facilitate the primer binding |
What happens in the reaction when the temperature shifts to 55°C during cycling?
the DNA polymerase will carry out DNA synthesis by extending the annealed primers | |
the DNA polymerase will finish DNA synthesis |
the primers anneal to the single-stranded regions of the DNA | |
the primers anneal to the double-stranded regions of the DNA |
During cycling, what occurs when the temperature is at 72°C?
the primers anneal to the double-stranded regions of the DNA | |
the DNA polymerase will carry out DNA synthesis by extending the annealed primers |
the primers anneal to the single-stranded regions of the DNA | |
the DNA polymerase will finish DNA synthesis |
You designed a set of primers to amplify 1 kb DNA with polymerase chain reaction. By which cycle of polymerase chain reaction, we would expect to see the first double stranded DNA with expected size?
The end of cycle 1 | |
The end of cycle 2 |
The end of cycle3 | |
The end of cycle 4 |