Log in
Biology
1
answer
0
watching
601
views

PCR Homework

Design a forward and a reverse primer ( 15 bases length ) to amplify the next DNA sequence

5’GGTGGTGCGCTTCCAAGAAGCAGCCAATAAGCAGAAGCAGGAACTCGACGAGATCTCGACGAATATTCGTCAGGCCGGCGTCCAATACTCGAGGGCCGACGAGGAGCAGCAGCAGGCGCTGTCCTCGCAAATGGGCTTCTGA3’

Name the reagents needed to do a PCR reaction

What is a DNA polymerase and why this enzyme from a thermoresistant microorganism must be used for the PCR?

The forward primer binds to the _____________ DNA chain and the ___________ primer bind to the main DNA chain that is the reason why we have to use the reverse _________ sequence to design the second primer

Watch
1
answer
0
watching
601
views

For unlimited access to Homework Help, a Homework+ subscription is required.

Elin Hessel
Elin HesselLv2
28 Sep 2019

Unlock all answers

Get 1 free homework help answer.
Already have an account? Log in
Share

Related textbook solutions

Molecular Cell Biology
8 Edition,
Lodish
ISBN: 9781464183393
Biology: Science for Life with Physiology
6 Edition,
Belk
ISBN: 9780134555430
Biology
2nd Edition, 2013
Openstax
ISBN: 9781947172517
Concepts of Biology
OER Edition,
Openstax
ISBN: 9781938168116
Essentials of Biology
5 Edition,
Mader
ISBN: 9781259660269

Related questions

Answered most of the questions. Can you tell me if my answers are correct? Last question of the month. Thank you. I appreciate it.

4. You perform electrophoresis on the product of a PCR and see that instead of the 300-base band you expected that there are five different bands.

What controls the specific sequence to which a PCR primer binds? Complementary sequence and annealing temperature control the specific sequence to which a PCR primer binds.

What are two factors that contribute to the annealing temperature of the primer? Two factors that contribute to the annealing temperature of the primer is primer length and the Guanine and Cytosine content.

What part of your thermal cycle protocol could you change, and how would you change it, to try and get rid of the extra bands?

To get rid of the extra band, we have to increase the annealing temperature.

If, after performing electrophoresis, there were no bands on the gel, what part of your thermal cycle protocol would you change, and how would you change it?

After performing electrophoresis, if there were no bands on the gel then we have to decrease the annealing temperature of the primer

5. If you are using a DNA sequence from a related species to design primers for your species of interest, why is it better to design your primers to complement an exon?

In related species there are similarities but their genetic makeup will not be the same. It is better to design your primers to complement an exon because ??

6. Why is it better to use a 25-base primer than a 10-base primer? Why do you have to have a lower annealing temperature for a 10-base primer?

It is better to use a 25-base primer than a 10-base primer because a 10-base primer is not long enough and may pair with a wrong portion of DNA, which would give wrong results. You have a lower annealing temperature for a 10-base primer because annealing temperature increases when the number of base pairs increase. If the temperature is too high the primer might not bind.

Identify the three steps in PCR and tell the function of each step.

Denaturation - when the double-stranded DNA is heated to 92-95℃ for about one minute, to separate it into two single strands.

Annealing - temperature of the reaction is lowered to a temperature that is between 45℃ and 65℃ to allow the DNA primers to attach to the template DNA.

Extension - temperature of the reaction is raised to a temperature between 45℃ and 65℃ and the new strand of DNA is made by adding nucleotides to the ends of the primers.

2

a) You also wish to synthesize a degenerate oligonucleotide primer that could be used eventually to clone DNA that encodes your mutant protein. Design this degenerate oligo, keeping in mind the rules we talked about in class. More information about designing degenerate primers and primers in general are located on the following page.

Write out the sequence of this oligo here

b) If you synthesized the above oligonucleotide primer, how many different oligos would be present in the mixture?

RULES TO FOLLOW for creating primers (Modified from the Thermo Fisher web site):

Designing degenerate primers:

Write out your amino acid sequence, label amino and carboxy termini

For each amino acid, use the genetic code to predict the various nucleic acid codons that can encode this amino acid. For all but Met, you should have redundancy present.

Now you need think about 5’ and 3’ considerations, and keep in mind that DNA within genes is double-stranded. It is helpful to keep in mind that the 5’ end of a gene corresponds to the amino terminus of a protein. Using 5’ and 3’ labels write out a single strand DNA sequence corresponding to the your amino seq of interest. You may choose to start with only possible codon for each amino acid, or you can do all possibilities using the notation I showed you in class to account for the wobble position of codons.

Now make your DNA double stranded by filling in the opposite DNA strand; label the 5’ and 3’ ends of this second strand and make sure you have an anti-parallel arrangement of DNA strands.

If you haven’t already, now consider the redundancy present on both strands, and make sure you have indicated sequences that account for all possible redundancies.

Realize that when a researched synthesizes a degenerate oligo that the final synthesis contains oligos with every substitution possible. The amount of degeneracy is defined by the number of different primer combinations in the mix. You can determine the degree of degeneracy by multiplying the number of changes present at each position together. If a position has no degeneracy then you multiple by 1 for that position.

Keep in mind that the trade-off between primer specificity and efficiency can be modified by altering the degeneracy of the primer. For example, the more degenerate the primers, the less specific annealing will be; however, decreased degeneracy will allow more potential to identify unknown variants. Anything over 1024 fold degeneracy is at the upper limit of potential usefulness.

Designing Primers:

Good primer design is essential for a successful PCR reaction. There are many factors to take into account when designing the optimal primers for your gene of interest. This information is taken from the Fisher Scientific website and are used when actually designing an experiment. Here are some tips to consider when designing primers.

In general, a length of 18 nucleotides is the minimum necessary for efficient primer binding.

Try to make the melting temperature (Tmm) of the primers between 65°C and 75°C, and within 5°C of each other.

If the Tmm of your primer is very low, try to find a sequence with more GC content, or extend the length of the primer a little.

Aim for the GC content to be between 40 and 60%, with the 3' of a primer ending in C or G to promote binding. This is called a GC clamp.

Typically, 3 to 4 nucleotides are added 5’ of the restriction enzyme site in the primer to allow for efficient cutting. Restriction enzymes are ENDO nucleases, so they cut better when their recognition site is not on the end of DNA.

Try to avoid regions of secondary structure, and have a balanced distribution of GC-rich and AT-rich domains.

Avoid intra-primer homology (more than 3 bases that complement within the primer) or inter-primer homology (forward and reverse primers having complementary sequences). These circumstances can lead to self-dimers or primer-dimers instead of annealing to the desired DNA sequences.


Please answer all

Why does a template-dependent DNA polymerase require a primer to initiate DNA synthesis?

DNA polymerase require 5' phosphate to add a new nucleotide

DNA polymerase require 3' hydroxyl group to add a new nucleotide

DNA polymerase require energy by hydrolizing the primers

Which of the following enzymes is template independent?

Reverse transcriptase

Klenow fragment

DNA polymerase

Terminal deoxynucleotidyl transferase

RNA polymerase

The natural function of a DNA ligase enzyme is:

Joining together DNA sequences with compatible cohesive ends from two different organisms to yield a recombinant DNA molecule

Sealing single stranded nicks in double stranded DNA molecules

Joining together two blunt ended fragments of DNA within a cell

Joining together two single stranded DNA molecules

The natural function of 3' -> 5' exonuclease activity of a DNA polymerase is to:

Remove the 5' end of the DNA strand that is being copied

Remove damaged nucleotide from the template strand

Remove nucleotides from the end of DNA to generate blunt ends

Remove incorrect nucleotides from the newly synthesized DNA

Which technique is used to resolve the different sizes of DNA fragments?

Gene cloning

PCR

DNA sequencing

Gel electrophoresis

Which of the following vectors does not contain bacterial origin of replication (oriC)?

plasmid

cosmid

bacterial artificial chromosome

lambda vector

Which process of bacteriophage is not used for gene cloning?

Concatemer formation

Lytic cycle

Lysogenic cycle

viral packaging

What vector would be best suited for creating a contig of bovine (cattle) chromosome 10?

lambda vector

Cosmid vector

P1 vector

Plasmid

E. coli takes up plasmid DNA by which of the following methods?

Transduction

Transformation

Conjugation

Transfection

The following times and temperatures are an example of the steps for PCR. You can use the Figure to help you answer the following questions.

Why is the first step is carried out at 94°C?

To degrade the template

To denature the template

To activate the polymerase

To facilitate the primer binding

What happens in the reaction when the temperature shifts to 55°C during cycling?

the DNA polymerase will carry out DNA synthesis by extending the annealed primers

the DNA polymerase will finish DNA synthesis

the primers anneal to the single-stranded regions of the DNA

the primers anneal to the double-stranded regions of the DNA

During cycling, what occurs when the temperature is at 72°C?

the primers anneal to the double-stranded regions of the DNA

the DNA polymerase will carry out DNA synthesis by extending the annealed primers

the primers anneal to the single-stranded regions of the DNA

the DNA polymerase will finish DNA synthesis

You designed a set of primers to amplify 1 kb DNA with polymerase chain reaction. By which cycle of polymerase chain reaction, we would expect to see the first double stranded DNA with expected size?

The end of cycle 1

The end of cycle 2

The end of cycle3

The end of cycle 4

Weekly leaderboard

Home
Homework Help 3,900,000
Biology 460,000
Start filling in the gaps now
Log in