answer

watching

views

8 Nov 2018

Following is a sequence of a DNA segment of E.coli:

+1

5' CATACATGGTATAATGACGTTACCCGACATAGCTACGATGACGATA 3'

3' GTATGTACCATATTACTGCAATGGGCTGTATCGATGCTACTGCTAT 5'

Answer the following parts:

1. Mark the core promoter element.

2. What is the significance of +1?

3. Write down the sequence of sense RNA strand produced from this above DNA sequence.

4. Describe the sequence in which the eukaryotic basal transcription factors assemble in the transcription initiation complex.

answer

watching

views

For unlimited access to Homework Help, a Homework+ subscription is required.

You have 0 free answers left.
Get unlimited access to 3.8 million step-by-step answers.

Get unlimited access

Already have an account? Log in

Sixta KovacekLv2

10 Nov 2018

Unlock all answers

Get 1 free homework help answer.

Already have an account? Log in

Related questions

Which type of RNA is unique to eukaryotes?

		mRNA
		rRNA
		tRNA
		snRNA
		Its a trick, all cells have all four types of RNA.

1 points

QUESTION 2

The region of DNA to which RNA polymerase binds to initiate transcription is the:

		origin
		promoter
		enhancer
		none of the above are correct

1 points

QUESTION 3

Holoenzyme:

		is RNA polymerase core enzyme.
		is sigma factor.
		is core plus sigma factor.
		none of the above are correct.

1 points

QUESTION 4

Which of these is formed FIRST when RNA polymerase binds to a promoter?

		The closed promoter complex
		The open promoter complex
		A rho-independent terminator
		none of the above are correct.

1 points

QUESTION 5

A hairpin loop followed by a run of Us:

		is the sequence formed in the sense strand of a gene using a rho-independent terminator.
		is the sequence recognized by the rho protein.
		is the structure formed in RNA that causes rho-independent termination.
		is formed immediately after the open promoter complex is formed.

1 points

QUESTION 6

RNA polymerase:

		reads the template strand of the DNA in the 3' to 5' direction.
		synthesizes the RNA in the 5' to 3' direction.
		can begin transcription without a primer.
		all of the above are correct.

1 points

QUESTION 7

Which of the following statements is FALSE?

		Bacteria like E. coli have only one type of sigma factor.
		RNA polymerase has no proofreading activity.
		The promoter of a gene is upstream of the RNA-coding region.
		Bacterial transcriptional terminators are copied into RNA to cause termination.

1 points

QUESTION 8

If the template strand of a gene has the sequence 5' ATGCGAT 3', then:

		the RNA produced will have the sequence 5' AUGCGAU 3'.
		the RNA produced will have the sequence 5' UAGCGUA 3'.
		the RNA produced will have the sequence 5' AUCGCAU 3'.
		None of the above are correct.

1 points

QUESTION 9

The sense strand:

		is the lagging strand
		is also the template strand.
		always goes left to right.
		none of the above are correct.

1 points

QUESTION 10

Which of these is transcribed but not translated?

		mRNA
		tRNA
		rRNA
		all of the above
		tRNA and rRNA are transcribed but not translated.

please help i am a bit confused

1) In Eukaryotes, repetitive sequence inclues:
A) Centromere sequences
B) Telomere sequences
C) All of the above

2) Satelit DNA:
A) Was orignally discoverd in E. Coli
B) Represents plasmid DNA sequences
C) Contains repetitive DNA sequences
D) Has the same density as main band DNA
E) All of the above

3) Inversions _____ The number of crossover offspring.
A) Decrease
B) Increase
C) Do not change
(I Believe the answer is "C" ^. can you explain why?)

4) In human genome, repetitive DNA is estimated to be ___ of the total genome.
A) .1%
B) 1%
C) 10%
D) 50%
E) 90%

5) In E. Coli, the promoter sequence:
A) Contains a short AT rich sequence
B) Binds transcription factors
C) All of the above

6) In eukaryotic transcription:
A) Transcription factors bind to the promoter and then RNA polymerase binds.
B) Transcription factors bind to RNA polymerase which then binds to the promoter
C) Transcription factors are NOT required to initiate transcription

Explanation for each would help immensely. THANK YOU in advance for your time!!!

cerisebadger105

1 DNA sequences found in introns provide [A] amino acid sequence information.

[B] regulatory information.
[C] no known useful information.

[D] structure for the gene.
[E] alternative DNA splicing possibilities.

3. The TATA box is a(n)
[A] sequence close to the promoter region of many genes.
[B] square-shaped sequence.
[C] enhancer consensus sequence.
[D] activator sequence necessary for proper translation.
[E] None of the above

5. Regarding genes and gene expression, which of the following is not a difference between prokaryotes and eukaryotes
[A] Eukaryotic DNA does not contain a TATA box close to the initiation site as does prokaryotic DNA.

[B] In eukaryotes, RNA polymerase requires

'transcription factors'or initiation.

[C] Prokaryotic genes are often grouped together in

operons.

[D] In eukaryotes, the regulation of several genes at once requires common control elements in each of the genes.
[E] There is a diversity of eukaryotic polymerases that is reflected in the diversity of eukaryotic promoters.

10) In eukaryotic cells, a repressor

[A] is made of DNA.
[B] binds to the enhancer region to block transcription. [

C] is located both upstream and downstream from the promoter.
[D] binds to the operator to block RNA polymerase.

[E] binds to a silencer to reduce transcription rates.

Coordinated regulation of genes in eukaryotic cells [A] is the result of positioning the same regulatory sequence in front of each gene.
[B] results from all of those genes being under the control of one promoter.

[C] occurs because related genes all have the same

operons.
[D] occurs because enhancers cause DNA to bend.