BIO SCI 93 Chapter Notes - Chapter 12.3: Metastasis, Estrogen Receptor, Metaphase

61 views13 pages

alpha-science-x3

10 May 2016

School

Department

Course

Professor

For unlimited access to Textbook Notes, a Class+ subscription is required.

blushzebra850 and 37920 others unlocked

BIO SCI 93 Full Course Notes

Verified Note

40 documents

Document Summary

The eukaryotic cell cycle is regulated by a. Molecular control system: the frequency of cell division varies within the type of cell. A cyclically operating set of molecules in the eukaryotic cell that both triggers and coordinates key events in the cell cycle. A control point in the cell cycle where stop and go-head signals can regulate the cycle. Dependent kinases: regulatory molecules are mainly proteins of two types: Kinases: enzymes that activate or inactivate other protein by phosphorylating them. Cyclins: a protein that gets its name from its cyclically fluctuating concentration in the cell, to be active, kinase must be attached to a cyclin are called cyclin-dependent kinases (cdks) A protein kinase that is active only when attached to a particular cyclin. The activity in a cell rises and falls with changes in the concentration of its cyclin partner. A protein complex required for a cell to progress form late interphase to mitosis.

Related Questions

Suppose you are a director of a ballet theater. After reading abook about the cell cycle, you are intrigued by the similaritybetween your night show and the cell cycle. Each night the theaterfills, the lights go out, the curtain rises, the dancers perform,the curtain falls, the lights go on, and the spectators leave, justlike the cell cycle consisting of a defined sequence of events. Soyou decided to improve theater operation by incorporatingcheckpoint mechanisms similar to the cell cycle control system.First, you designed a system that raises the curtains automaticallywhen all the seats are filled. In each seat, sensors were installedto detect a seated person. But you have not decided how to connectthe sensors to the curtains.

a) You can set the sensors to send out a positive signal that addsup to be enough to raise the curtain or set each sensor to send outa negative signal that will stop the curtain from going up untilevery seat is filled. Which system do you think a cell would usefor cell cycle control? (1 point)

b) Compare advantages and disadvantages of the two modes andexplain your answer. (Your shows are so popular that all the seatsare filled in each show. You don

erinmanatee852

You have discovered a new gene âXâ that appears to be regulated by 3 transcription factors (E2F, SP-1 and C/EBPa). Another gene âYâ appears to also be regulated by these same proteins. Both genes are involved in cell cycle initiation but gene Y is expressed later in the cell cycle than gene X.

The DNA sequence at the promoter region is GCGCCAATGTGCTGACAGTTAATTAGGGCTA

The known DNA consensus sequence for each Transcription Factor is:

E2F â GCCAATGTGCTGA

SP-1 â GCTGACAGTTAA

C/EBPa â ACAGTTAATTAGG

Design a series of experiments that will investigate the regulation of Gene X and Gene Y. All proteins and gene sequences are known. You have a large well-funded lab.

not too details, just main points please...

1. What you should know about microtubles

- MT structure, what they are made of

- MT function

- Motor proteins(kinesins&dyneins)

- How kinesins move, coupling to ATP hydrolysis

- Microtubule Organizing Center (MTOC), how MTs are nucleated

- MT dynamics, how it's affected by drugs and MAPs

- dynamic instability and how its linked to GTP/GDP cycle

- cilia/flagella, axoneme structure

- how cilia/flagella move and the role of dynein

-intra-flagellar transport

2. What you should know about actin filaments

- F-actin structure

- F-actin Function

- Motor proteins (myosins)

- Actin dynamics, how it's affected by actin-binding proteins

- the concept of critical concentration

- actin/myosin structure and function in the contezt of muscle

- how muscle contract

- actinomyosin cycle (myosin movement), coupling to ATP hydrolysis

- How cells move and change shape, using actin

3. What you should know about IF

- IF strcuture, what they are made of

- IF function, roles inside and outside cells

- Regulation of nuclear IF in the cell cycle

- be able to compare major features of IF, Actin, and MTs

Bacterial cytoskeleton, that bacteria have proteins that

- polymerize

-affect cell shape, cytokinesis, ect.

- play analogous roles to MT, F-actin

4. what you should know about the cell cycle

- parts of the cell cycle, stages of mitosis

- MPF; how it was identified, what it is made of (cyclin and cdk)

- Universality of cyclin/Cdks (in yeast, frogs, etc.)

-how Cdk activity is regulated (many mechanisms)

- how Cdks function (by phosphorylation)

- how multiple cdks divide their function

- how the spindle is formed and mistakes corrected

- the role of motors and MY dynamics in above

- the tolr of proteolysis in mitotic transitions

- what a checkpoint is

- how checkpoints provide an additional layer of cell cycle regulation in case of damage

pearcrab948

BIO SCI 93 Chapter Notes - Chapter 12.3: Metastasis, Estrogen Receptor, Metaphase

BIO SCI 93 Full Course Notes

Document Summary

Get access

Related textbook solutions

Molecular Cell Biology

Biology: Science for Life with Physiology

Concepts of Biology

Biology

Essentials of Biology

Related Documents

BIO SCI 93 Chapter Notes - Chapter 13.3: Synaptonemal Complex, Gamete, Fundamental Theorem Of Arithmetic

BIO SCI 93 Chapter Notes - Chapter 9.4: Oxidative Phosphorylation, Atp Synthase, Flavin Mononucleotide

BIO SCI 93 Chapter Notes - Chapter 10: Photophosphorylation, Central Cross-Island Highway, Carbon Fixation

Related Questions