Biology 1001A Chapter Notes - Chapter Cycle 2: Erwin Chargaff, Dna Replication, Nitrogenous Base

28 views1 pages

peachwildebeest270

11 Dec 2017

School

Western University

Department

Biology

Course

Biology 1001A

Professor

Beth Mac Dougall- Shackleton

For unlimited access to Textbook Notes, a Class+ subscription is required.

Document Summary

Section 12. 2: dna replication is bi-directional, semi-conservative, semi-discontinuous. 12. 2a dna consists of four nucleotides; each nucleotide has a five-carbon sugar (deoxyribose), a phosphate group, and an nitrogenous base (either adenine, guanine, thymine, and cytosine). Adenine and guanine are purines, which are nitrogenous bases built from a pair of fused rings of carbon and nitrogen atoms (ie. double-ring structures) Thymine and cytosine are pyrimidines, which are built from a single carbon ring (ie. single-ring structures) Erwin chargaff, measured the amounts of nitrogenous bases in dna and discovered that they occur in definite ratios. The polynucleotide chain of dna has polarity, or directionality. 12. 3a matthew meselson and franklin stahl has showed that dna replication is semi- conservative. They used a nonradioactive heavy nitrogen isotope to tag the parental dna.

Related Questions

Question 4

Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)

Guanine

histone

Double helix

Adenine

conservative

cytosine

Okazaki fragments

Thymine

introns

Leading strand

RNA polymerase

5-prime to 3-prime

Uracil

chromatin

DNA ligase

Semi-conservative

promoter

Lagging strand

DNA polymerase

nucleosomes

Electron transport chain

enhancer

Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.

Question 5

In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."

Lactose	Glucose	Lac expression?
No	Yes
Yes	Yes
Yes	No

Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.

Question 6

Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)

a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5âAUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3â

b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.

c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

plumgoat220

Biology 1001A Chapter Notes - Chapter Cycle 2: Erwin Chargaff, Dna Replication, Nitrogenous Base

Document Summary

Get access

Related Documents

Biology 1001A Lecture Notes - Lecture 5: Deoxyribose, Dna Replication, Cytosine

Biology 1001A Chapter Notes - Chapter 12.2: Thymine, Purine, Base Pair

Biology 1001A Chapter Notes - Chapter 12.3-12.4: Base Pair, Phosphodiester Bond, Dna Clamp

Related Questions