Biochemistry 2280A Study Guide - Final Guide: Ecorv, Ecori

55 views2 pages

sangriaminnow269

8 Nov 2017

School

Department

Course

Professor

For unlimited access to Study Guides, a Grade+ subscription is required.

Document Summary

You are given a sample of a linear double stranded dna fragment. You are to determine the number and order of restriction cut sites in that dna. You divide the dna sample into three aliquots. In your first experiment you digest one aliquot of the dna sample with ecorv (rv) and after gel electrophoresis you observed three bands indicating fragments 25kb 17kb and 15kb in size. You then digest the second aliquot with ecori (ri) and after gel electrophoresis you observe three bands indicating fragments that are 25kb, 20kb and 12kb in size. With the third aliquot you perform a double digest using ecorv and ecori and you observe four bands indicating fragment sizes of 20kb, 15kb 12kb and 5kb in size. If you add up all the fragments produced by a single digest with either enzyme, it comes to 57kb. So, the fragment being cut is 57kb long.

Related Questions

:Patientswith a particular form of hemophilia (a deficiency in bloodclotting) have a loss of an EcoRI restriction site within the genefor a coagulation factor protein. In one family with an affectedson, PCR analysis was carried out on blood samples from a malefetus and from several family members to determine whether thefetus carried the mutation. Following PCR amplification of theappropriate 150 bp (base-pair) DNA fragment, the fragments wereincubated with EcoRI and the resulting cleavage fragments separatedby electrophoresis on an agarose gel and stained with ethidiumbromide.

1.) A restriction recognition site is repeated 1 times on a circular DNA molecule. If you treat this DNA molecule with this restriction enzyme, how many DNA fragments will you get?

a. 1

b. 2

c. 3

d. Restriction enzyme does not cut a circular molecule

2.) In an agarose gel DNA electrophoresis, the DNA fragments are separated based on their

a. Size

b. Electrical charge

c. Nucleotides sequences

d. Density

e. All of the above

3.) DNA molecules are usually separated using agarose gel rather than polyacrylamide because:

a. Agarose polymerizes faster than acrylamide gel

b. Polyacrylamide gel has pore size larger than the size of DNA molecules

c. Agarose gel do not have pores on tis matrix and can hold large DNA molecules

d. Agarose gel has larger pore size similar to the size of DNA molecules

4.) Restriction endonucleases

a. Randomly recognize and cut DNA sequences

b. Hydrolysis the phosphodiester bond of DNA backbone

c. Recognize specific sequence on double stranded DNA

d. A and B

e. B and C

taupefrog573

Background info:

You have identified an organism with the smallest known genome (sequence below). You isolate the DNA and digest it with EcoR1

EcoRI --- 5' G âAATTC 3'

5' ACGACGTATTAGAATTCTTATCCGCCGCCGGAATTCTCATCA 3'

3â TGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5â

Look for palindromic site, specific for restriction enzyme, each strand of the DNA is âcutâ (phosphodiester bond of backbone is cleaved) at the same place in the sequence, this will produce sticky ends

The key steps in the experiment:

1. Extract DNA from organism (how would you do this, can you separate protein and nucleic acids, what about DNA from RNA)

2. Incubate DNA with restriction enzyme (what is you used the wrong enzyme? What if you accidentally boiled your sample?

3. Use gel electrophoresis to separate out DNA fragments by size (need a gel, need an electrical current, buffer)

4. Use Ethidium Bromide (EtBr) either in the gel or as a stain afterwards (this will allow for visualization of the DNA, non-specific, ring structure intercalates with bases, excited by UV light, emits orange light)

5. Include a ladder/controls â (you need ladder or something of known size if you want to estimate the size of the fragments)

6. Visualize with UV light source and imager

7. Important â maybe not as key - Use loading dye when loading DNA buffer (the buffer helps the DNA settle into the well, dye lets you approximate where the DNA should be in the gel as it is running)

______________________________________________________________________________________

Here is the question I would like to know:

1) What would happen if we changed something in the experiment?

A) What would happen if we changed step 1?

b) What would happen if we changed step 2?

c) What would happen if we changed step 3?

d) What would happen if we changed step 4?
e) What would happen if we changed step 5?

f) What would happen if we changed step 6?

g) What would happen if we changed step 7 (if anything) ?

Biochemistry 2280A Study Guide - Final Guide: Ecorv, Ecori

Document Summary

Get access

Related Documents

Biochemistry 2280A Lecture : Restriction Mapping

Biochemistry 2280A Chapter Notes - Chapter 10: Restriction Enzyme, Agarose Gel Electrophoresis, Molecular Cloning

Biochemistry 2280A Chapter Notes - Chapter 10: Nucleic Acid Hybridization, Sanger Sequencing, Dna Polymerase

Related Questions