BIO 3170 Study Guide - Midterm Guide: Structure Formation, Covalent Bond, Human Genome Project

34 views7 pages

rubytortoise417

25 Feb 2017

School

Department

Course

Professor

For unlimited access to Study Guides, a Grade+ subscription is required.

Lecture 1: Learning objectives

1. Identify covalent bonds and non covalent interactions important for the structure

formation of the DNA double helix.

find more resources at oneclass.com

Unlock document

This preview shows pages 1-2 of the document.
Unlock all 7 pages and 3 million more documents.

Already have an account? Log in

2. Why are the bases located at the center of the DNA double helix while the sugars

are found in the periphery?

find more resources at oneclass.com

Unlock document

This preview shows pages 1-2 of the document.
Unlock all 7 pages and 3 million more documents.

Already have an account? Log in

Related Questions

1.Why are non-covalent bonds important in biological systems?List at least three examples of non-covalent interactions.

2. You want to amplify at least the underlinedsequence, you can have some flanking sequence as well.

5âCTGCTACGTACTGGATGACTGACTGTGATGATCTGATCCCAGTGCTCGTAGTCGTGCGTTCGTAATATATAGCGATGGCGCGATGCGATGCGCGTAGCGGCTAGGCGTAGGCGGATTCGGCTAGGCGATGGCGATGGCGATGCGATATTCTAGCGCTAGCGATGAGGTGATTATATCGGCGCTAGCTGATCGTAGCTGATCG3â

Design the most optimal primers according to Tm and length.Write out each primer and show which is the 5â and 3â end of eachprimer.

How big will your PCR product be?

3.. What are the differences between covalent bonds andnon-covalent bonds? Where are each found?

harlequinllama879

Relate the following columns:

A. In the complementary strands of DNA are exposed to the aqueous environment.	( ) Bridges of H.
B. They are in the hydrophobic interior of the DNA double helix.	( ) 2-DNA.
C. They are van der Waals interactions between pairs of stacked bases.	( ) Sugar-phosphate skeletons.
D. They are an important stabilizing force between base pairs.	( ) Purines and pyrimidines.
E. It's the approximate conformation found in the cells.	( ) A-DNA.
F. It's favored when the DNA is dehydrated:	( ) Stacking interactions.
G. It's favored in certain sequences rich in G/C	( ) B-DNA.
H. The protein machinery that carries out DNA polymerization.	( ) Okazaki fragments.
I. Short fragments of DNA strand.	( ) DNA Helicase.
J. Just with DNA-PolIII and other proteins is a part of the replisome.	( ) Primosome.
K. Synthesize the RNA primers.	( ) Primase.
L. Unroll the two strands of the parent double helix.	( ) SSB.
M. It joins the double strand and prevents it from bending back.	( ) Replisome.

1) Describe the evidence that Watson and Crick used to come upwiththe double helix model for DNA.

2) How does the double-helical structure of DNA relate to itsfunction?

bluepanda857

BIO 3170 Study Guide - Midterm Guide: Structure Formation, Covalent Bond, Human Genome Project

Get access

Related textbook solutions

Molecular Cell Biology

Biology: Science for Life with Physiology

Biology

Concepts of Biology

Essentials of Biology

Related Documents

BIO 3170 Midterm: BIO3170 Midterm: BIO3170 Midterm 1: Lecture 1 - 6 Learning Objectives

BIO 3170 Lecture Notes - Lecture 1: The Double Helix, Central Dogma Of Molecular Biology, Protein Folding

BIO 3170 Lecture Notes - Lecture 4: Pyrimidine Dimer, Depurination, Pyrimidine

Related Questions