BIOL239 Quiz: Set 17- Cloning

154 views8 pages

scarletbee935

8 Apr 2017

School

University of Waterloo

Department

Biology

Course

BIOL239

Professor

Christine Dupont

For unlimited access to Study Guides, a Grade+ subscription is required.

Document Summary

Cloning: summary, to reduce the size of large dna strands, researchers use restriction enzymes (endonucleases, these enzymes protect prokaryotic cells from viral infection by digesting viral. In order to analyze these fragments, researchers must isolate and clone the isolated molecules to analyze the isolated dna fragment: molecular cloning is a process that consists of two steps, 1. Dna fragments that fall within a specified range of sizes are inserted into specialized chromosome-like carriers called vectors which insure the transport, replication and purification of individual inserts: 2. How do they cut: type ii ren (restriction endonucleases) recognize inverted palindromic sequences in dna. Sticky ends cut at beginnings and end of palindrome, making naked base pairs: explain why ecori will cut. 3"gcaa(gaattc)catgg5: ecori looks for the ga at the start and end, in the later version the ctt is at the start so won"t work, remember read 5" to 3, describe gel electrophoresis, gel electrophoresis distinguishes.

Related Questions

Background info:

You have identified an organism with the smallest known genome (sequence below). You isolate the DNA and digest it with EcoR1

EcoRI --- 5' G âAATTC 3'

5' ACGACGTATTAGAATTCTTATCCGCCGCCGGAATTCTCATCA 3'

3â TGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5â

Look for palindromic site, specific for restriction enzyme, each strand of the DNA is âcutâ (phosphodiester bond of backbone is cleaved) at the same place in the sequence, this will produce sticky ends

The key steps in the experiment:

1. Extract DNA from organism (how would you do this, can you separate protein and nucleic acids, what about DNA from RNA)

2. Incubate DNA with restriction enzyme (what is you used the wrong enzyme? What if you accidentally boiled your sample?

3. Use gel electrophoresis to separate out DNA fragments by size (need a gel, need an electrical current, buffer)

4. Use Ethidium Bromide (EtBr) either in the gel or as a stain afterwards (this will allow for visualization of the DNA, non-specific, ring structure intercalates with bases, excited by UV light, emits orange light)

5. Include a ladder/controls â (you need ladder or something of known size if you want to estimate the size of the fragments)

6. Visualize with UV light source and imager

7. Important â maybe not as key - Use loading dye when loading DNA buffer (the buffer helps the DNA settle into the well, dye lets you approximate where the DNA should be in the gel as it is running)

______________________________________________________________________________________

Here is the question I would like to know:

1) What would happen if we changed something in the experiment?

A) What would happen if we changed step 1?

b) What would happen if we changed step 2?

c) What would happen if we changed step 3?

d) What would happen if we changed step 4?
e) What would happen if we changed step 5?

f) What would happen if we changed step 6?

g) What would happen if we changed step 7 (if anything) ?

Please answer all

Why does a template-dependent DNA polymerase require a primer to initiate DNA synthesis?

	DNA polymerase require 5' phosphate to add a new nucleotide
	DNA polymerase require 3' hydroxyl group to add a new nucleotide

DNA polymerase require energy by hydrolizing the primers

Which of the following enzymes is template independent?

	Reverse transcriptase
	Klenow fragment

	DNA polymerase
	Terminal deoxynucleotidyl transferase

RNA polymerase

The natural function of a DNA ligase enzyme is:

	Joining together DNA sequences with compatible cohesive ends from two different organisms to yield a recombinant DNA molecule
	Sealing single stranded nicks in double stranded DNA molecules

	Joining together two blunt ended fragments of DNA within a cell
	Joining together two single stranded DNA molecules

The natural function of 3' -> 5' exonuclease activity of a DNA polymerase is to:

	Remove the 5' end of the DNA strand that is being copied
	Remove damaged nucleotide from the template strand

	Remove nucleotides from the end of DNA to generate blunt ends
	Remove incorrect nucleotides from the newly synthesized DNA

Which technique is used to resolve the different sizes of DNA fragments?

	Gene cloning
	PCR

	DNA sequencing
	Gel electrophoresis

Which of the following vectors does not contain bacterial origin of replication (oriC)?

	plasmid
	cosmid

	bacterial artificial chromosome
	lambda vector

Which process of bacteriophage is not used for gene cloning?

	Concatemer formation
	Lytic cycle

	Lysogenic cycle
	viral packaging

What vector would be best suited for creating a contig of bovine (cattle) chromosome 10?

	lambda vector
	Cosmid vector

	P1 vector
	Plasmid

E. coli takes up plasmid DNA by which of the following methods?

	Transduction
	Transformation

	Conjugation
	Transfection

The following times and temperatures are an example of the steps for PCR. You can use the Figure to help you answer the following questions.

Why is the first step is carried out at 94Â°C?

	To degrade the template
	To denature the template

	To activate the polymerase
	To facilitate the primer binding

What happens in the reaction when the temperature shifts to 55Â°C during cycling?

	the DNA polymerase will carry out DNA synthesis by extending the annealed primers
	the DNA polymerase will finish DNA synthesis

	the primers anneal to the single-stranded regions of the DNA
	the primers anneal to the double-stranded regions of the DNA

During cycling, what occurs when the temperature is at 72Â°C?

	the primers anneal to the double-stranded regions of the DNA
	the DNA polymerase will carry out DNA synthesis by extending the annealed primers

	the primers anneal to the single-stranded regions of the DNA
	the DNA polymerase will finish DNA synthesis

You designed a set of primers to amplify 1 kb DNA with polymerase chain reaction. By which cycle of polymerase chain reaction, we would expect to see the first double stranded DNA with expected size?

	The end of cycle 1
	The end of cycle 2

	The end of cycle3
	The end of cycle 4

1. In a successful PCR reaction, which of the following is true?

a. The template DNA is added in excess of the primers and dNTPs.

b. The annealing temperature must be just below the melting temperature of the primers.

c. The temperature for the denaturation step is 72 C

d. All of the above

2. In our TLC experiment, which of the following had an effect on the migration of the samples?

a. The number of negatively charged phosphate groups

b. The protonation state of ionizable groups on the bases.

c. The size of the molecule.

d. All of the above

3. Which of the following is true of nucleic acid migration in agarose gel electrophoresis?

a.Nicked circular plasmids migrate faster than supercoiled plasmids.

b.Binding of ethidium bromide during electrophoresis speeds up the movement of linear fragments.

c.A higher percentage of agarose will decrease the migration of larger DNA fragments.

d.A lower strength electric field will increase the migration of DNA fragments.

4.What is the purpose of the outgrowth period during transformation?

a.To allow for the cells to take up DNA.

b.To allow for expression of the lacZÎ± and lacZÏ genes.

c.To allow for expression of antibiotic-resistance genes.

d.To prepare cell membranes for electroporation.

5.Which of the following is true of ligase and ligation reactions?

a.Ligase facilitates H-bonds between the sticky ends created by restriction enzyme digestion.

b.Ligase is inactivated at 37 C.

c.DNA fragments must have a 5â PO₄ group for ligase to covalently join them together.

d.Vector must be added in molar excess to insert to favor recombinant plasmid formation.

BIOL239 Quiz: Set 17- Cloning

Document Summary

Get access

Related Documents

BIOL239 Lecture Notes - Lecture 8: Restriction Enzyme, Molecular Cloning, Cloning

BIOL239 Lecture Notes - Lecture 17: Restriction Enzyme, Recognition Sequence, Exonuclease

BIOL239 Lecture Notes - Lecture 27: Mitosis, Endonuclease, Electrophoresis

Related Questions