BIO-2131 Study Guide - Final Guide: Base Pair, Lysozyme, Rhodopsin

127 views4 pages

beigerhinoceros747

25 Feb 2020

School

Algonquin College

Department

Biology

Course

BIO-2131

Professor

For unlimited access to Study Guides, a Grade+ subscription is required.

Document Summary

Rank the following base pairs according to their stability. Help least stable most stable: most stable background image, background image, background image, background image, background image, background image least stable background image. The base pair adenine-cytosine occurs very rarely in nature. When the dna is replicated, one of the two daughters will contain a guanine-cytosine base pair in the location of the mutation, and the other daughter will contain an adenine-thymine base pair. Proteins perform a variety of functions in living organisms. The protein lysozyme (shown in the figure) is found in tears and saliva where it prevents infection by catalyzing the destruction of specific molecules on the surface of many kinds of bacteria. Enzymatic proteins, or enzymes, are chemical agents that selectively speed up chemical reactions without being consumed by the reaction. The simplified diagram of rhodopsin shows the protein embedded in the phospholipid bilayer of the membrane. Portions of the protein extend into the intracellular and extracellular spaces.

Related Questions

Epidemiology Epidemiology is the study of how often diseases occur in different people and why they occur. Epidemiology can help us track diseases and find out when an outbreak is occurring or if a disease is decreasing due to a public health interventions. Given the above information, what do you think is the role of the epidemiologist in data collection? What is John Snowâs (1854) influence on the foundation of modern epidemiology? What are the current 10 leading causes of death for all races/ethnicities? What, according to you, are the five most important human diseases associated with stress? Justify your answers with appropriate research and reasoning and comment on the postings of at least two peers as to whether you agree with their view on the diseases associated with stress.

I just need someone to interpret exactually what I'm suppose todo here. I understand how to compare the sequecnces, however Idon't know exactually how to put them in order. also I can't findout how to find the what chromosome the sequence came from. So farall I gather to do from this is to find which segments overlap, addthe length, tell how big the chromesomeContigs and ShotgunSequencing
In this chapter, we discussed how wholeâgenome shotgun sequencingmethods can be used to assemble chromosome maps. Recall that in thetechnique of shotgun cloning, chromosomal DNA is first digestedwith different restriction enzymes to create a series ofoverlapping DNA fragments called contiguous sequences, or"contigs." The contigs are then subjected to DNA sequencing, afterwhich bioinformaticsâbased programs are used to arrange the contigsin their correct order on the basis of short overlapping sequencesof nucleotides.

In this Exploring Genomics exercise, you will carry out asimulation of contig alignment to help you understand theunderlying logic of this approach to creating sequence maps of achromosome. For this purpose, you will return to the NationalCenter for Biotechnology Information BLAST site that was used inother Exploring Genomics exercises and apply a DNA alignmentprogram called bl2seq.

Exercise I: Arranging Contigs to Create a Chromosome Map
1. Access BLAST from the NCBI Web site athttp://www.ncbi.nlm.nih.gov/BLAST/. Locate and select the "Aligntwo sequences using BLAST (bl2seq)" category at the bottom of theBLAST home page. The bl2seq feature allows you to compare two DNAsequences at a time to check for sequence similarityalignments.

2. Below are eight contig sequences taken from an actual humanchromosome sequence deposited in GenBank. For this exercise we haveused short fragments; however, in reality contigs are usuallyseveral thousand base pairs long. To complete this exercise, copyand paste two sequences into the Align feature of BLAST and thenrun an alignment (by clicking on "Align"). (Hint: Access thesesequences from the Companion Web site so that you can copy andpaste the sequences easily.) Repeat these steps with othercombinations of two sequences to determine which sequences overlap,and then use your findings to create a sequence map that placesoverlapping contigs in their proper order. A few tips toconsider:

â¢Develop a strategy to be sure that you analyze alignments for allpairs of contigs.
â¢Only consider alignment overlaps that show 100 percent sequencesimilarity.
Sequence A
CTAATTTTTTTTGTATTTTTAATAGAGACGAGGTGTCACCATGTTGGACAGGCTGGTCTCGAACTCCTGACCTCAGGTGATCTGCCCACCTCAGCCTCCCAAAGTGCTGGGAT
TACAAGCATGAGCCACCACTCCCAGGCTTTATTTTCTATTTTTTAATTACAGCCATCCTAGTGAATGTGAAGTAGTATCTCACTGAGGTTTTGATTTGCATTTTTCTATGACA
ATGAACAATGTTTCATGTGCTTGTTGGCTGTTTGTATATCCTTTTTGGAGAAATACCAATTCATGTCCTTTGCCCATTTTTAAAGTGGATTGCATGTCTTTTTGTTGTTTAGT
TGTAAAGATGTGGGTTTTTCTTTTGAGACGGAGTCTCGCTGTCGCCTAGGCTGGAGTGCAGAGGCATGATCTCGGCTGACTGCAATCCCCACCTCCTGGCATCAAGAAGTTCT
CCTGCCTCAGCCTTCCAAGTAGCTGGGTTTACAGATGC

Sequence B
CTTTATCTCAGGACAATGAACCCGCAAGGAGAGGAAGAGCCAGTAATTCTATAGAGACTCGGAGGCGCAGGGGGCACGCTTAGTTAGAGTGGTGGTGGTATTTTCAGTGTTTT
CTGGTTTTATGATAAACACAAGCATCAATGTCTCAAGACTTTCATCTTTATCTTTTTTTTTTTTTTTTTTTTTTTCTTGAGACAGGGTTTCCCTCTGTCACCCAGGCTGGAGT
GCATTGGTGGTGTGATCTTGGCTTTCTGTAACCTCGGGCTTCTGGGCTCAAGCCGTTCTACTACCTCAGCCTCCCAAATAGCTAGAACTACAAGCGTGTGCTGCCACACCTGG
CTAATTTGTTGTATTTTATTTATTCATTTATTTTTGTGAAGACAAGGTCTTGCCATGTTGCCCAGGCTGGTCTCAGACTCCTGGGCTCAAGCAATCCACCCACCTTAGTCTCC
CAAAGTGCTGGGATTACAGGCGTGAGCCACCACACCCA

Sequence C
GGAATTTCACTCTTGTTGCCCAAGTTGGAGTGCAATGGCGCGATCTCAGCTCACTGCAACCTCCGCCTCCCAGGTTCAAACGATTCTCCTGCTTCACTCTCCCCAGTAGCTGG
GATTACAGGCTGCACCACCACACCTGGCTAATTTTTTTTGTATTTTTAATAGAGACGAGGTGTCACCATGTTGGACAGGCTGGTCTCGAACTCCTGACCTCAGGTGATCTGCC
CACCTCAGCCTCCCAAAGTGCTGGGATTACAAGCATGAGCCACCACTCCCAGGC

Sequence D
GCTTCATCTTTCTCTTCACCGTAAAACAGGAAAGTGTGTGGTGACCAGTATTTTAAGGGAAAGGCACTTACAGAGAATTAAGCATTTGACAAAATTTATTTACAGATATTTGT
CTGTGGACCACTTCCGCACCAGCTGTGCATGAGAGGGCTCATTGCTCTGAATTTGCCTCCTTGTCTGCACCCAGGAGACCGTTTCCCAGATCACGCAAACGCTGCCTTCTCCC
CACACCAGGGCCCTCAGCATGGGAATGACCTTCCAGCGCTGCACGTTTCCAATCCATGCTCTGTTTTTCAGTTCTGGCTCACAGAGGACTGCTGGTTGCAAGCAAACTTGTAT
CTGGGTCTTCA

Sequence E
CCTTAAGTGATCTACCTGTCTCTGCCTCTCAAAGTGCTGGGATTGCAGGCATAAGCCGCCATGCCCGGCCCAAAGTTTCTTTATATGTGCTGGATACTAGGCCCGTAACAGAT
ATACAATTTGTAAATATTTTCTCTCATTTTGAAGATTTTCTTTTCACTTTCTTGATAATGTCCTTTGTGTATTTTTTGATAATGTCCTTTGATACACAAAAGTTTTTAAGTTT
GATGAAGTTCAATTTACCTATTATTTTCTTTTGTTGTTCAT

Sequence F
TGTTTGTTTGTTTGTTTTGTTTCATTTTGTTTTTGAGACAGAGTCTTGTTCTGTCGCCCAGTGTAGAGTGCAGTGGCATAATCTCGGCTCACCGTAACCTCCGCCTCCCGGGT
TCAAGCAACTCTGCCTGCCTCAGCCTCCCAAGGAGCTGGGATTATAGACGCCCACCACCATGCCTGGTTAATTTTTGTAGTTTTTTTTAGTAGAGATGGGGTTTTGCCATTTT
GGCCAGGCTGGTCTTGAACTCCTGACCTCAGGTGATCTGCCCACCCTGGCCTCTCAAAGTGCTGGGATTACAGGTGTGAGCTGCCACACTCGGCCACAACAAATTTTTGCACC
AGTTGCTCACA

Sequence G
TCCTTTGATACACAAAAGTTTTTAAGTTTGATGAAGTTCAATTTACCTATTATTTTCTTTTGTTGTTCATTCATTTTGTGTCCTATGTAGGAATCTATTGCCAAATTCAAGGT
GATAAAGATTTACCCCTATGTTTCCTTCTAAGAGTTTTATTGTTTTAGCCCTGATATTTAGCTAAACTTAATTGATTTATTAAGTTTAATTTTCCTATGTGGTATGAAGTCAT
TTATCTTCTTTAGTTCAGGATCCAAGTGAAAGGGGCATCTTCTATCTGGGACATGCCATTCTCATGACAGAGGAAAAAGACAAAAAACTGACACATACAATGACTTTAAAACT
TCACTCA

Sequence H
GGGTTTTTCTTTTGAGACGGAGTCTCGCTGTCGCCTAGGCTGGAGTGCAGAGGCATGATCTCGGCTGACTGCAATCCCCACCTCCTGGCATCAAGAAGTTCTCCTGCCTCAGC
CTTCCAAGTAGCTGGGTTTACAGATGCCCACCACCATGCCTGGCTGGTTTTTGTATTTTTAGTAGACACGGGGTTTTACCATGTTGGCCGGGCTGGTCTGGAACTCCTAACCT
TAAGTGATCTACCTGTCTCTGCCTCTCAAAGTGCTGGGATTGCAGGCATAAGCCGCCATGCCCGGCCCAAAGTTTCTTTATATGTGCTGGATACTAGGCCCGTAACAGATATA
CAATTTGTAAA

3. On the basis of your alignment results, answer the followingquestions, referring to the sequences by their letter codes (Athrough H):

a.What is the correct order of overlapping contigs?
b.What is the length, measured in number of nucleotides, of eachsequence overlap between contigs?
c.What is the total size of the chromosome segment that youassembled?
d.Did you find any contigs that do not overlap with any of theothers? Explain.
4. Run a nucleotideânucleotide BLAST search (BLASTn) on any of theoverlapping contigs to determine which chromosome these contigswere taken from, and report your answer.
segment is, and what chromosome it came from. here's theassignment. I just need someone to interpret how I should go aboutdoing this.

viridianox52

1.Which of the following statements is most accurate regarding personality stability?

Because it has a biological basis in infant temperament, personality remains fairly stable throughout the life span.

Personality is mostly influenced by social roles and norms, so it is difficult to predict accurately.

People make many characteristic adaptations throughout life, which can cause substantial changes in personality over time.

Personality tends to be stable in adulthood but can be predicted only from about age 15 or older.

Research on the Rorschach inkblot test indicates that it:

reliably assesses id/ego/superego conflicts and specific psychological disorders related to these conflicts

does an excellent job of identifying specific psychological disorders

identifies many normal, healthy adults and children as psychologically disturbed

is the most reliable of the many projective tests in use

Research has shown that, in predicting the behavior of people we know, we:

are unable to perform above chance levels in our predictions

are less accurate in predicting their observable behavior than in predicting our own observable behavior

tend to predict that their behavior will be more negative than it actually is

are more accurate in predicting their observable behavior than in predicting our own observable behavior

Derrick feels that he deserves more than other people, and he often tries to manipulate people to get what he wants. Whenever someone challenges him, he gets very angry. Derrick likely:

has exceptionally high-esteem

has a collectivist perspective

has low self-esteem

is suffering from terror-management syndrome