BIO 1140 Lecture 17: BIO 1140 lectures 16-17

64 views6 pages

Document Summary

Going to read each nucleotide 3 at a time and each codon is something different. Code is the available words that you can use to make the sentence that the rna is trying to say. To minimize mistakes, there are no two codons that mean the same thing, no ambiguity. Can use more than 1 codon for the same amino acid but no codon codes for 2 amino acids. All mrna will start with aug, the start codon. Don"t correspond to any amino acid but signal that the ribosome has come to the end of the code. Using the codon table, determine the sequence of amino acids obtained with the following mrna 5" auggguuauagcaccacuuga 3". When the trna brings the amino acid to the ribosome there is flexibility the first 2 nucleotides must be absolute and the difference lies in the 3rd.

Get access

Grade+
$40 USD/m
Billed monthly
Grade+
Homework Help
Study Guides
Textbook Solutions
Class Notes
Textbook Notes
Booster Class
10 Verified Answers
Class+
$30 USD/m
Billed monthly
Class+
Homework Help
Study Guides
Textbook Solutions
Class Notes
Textbook Notes
Booster Class
7 Verified Answers

Related textbook solutions

Related Documents

Related Questions