BIO 1140 Lecture Notes - Lecture 15: Lac Repressor, Allolactose, Repressor

35 views5 pages

raspberrypug641

4 Apr 2016

School

University of Ottawa

Department

Biology

Course

BIO 1140

Professor

Caroline Petit- Turcotte

For unlimited access to Class Notes, a Class+ subscription is required.

Document Summary

Explain the diferences between prokaryotes and eukaryotes when answering the following: Which strand is the polymerase reading to synthesize the new mrna strand. Have been talking about transcripion; next we"re taking mrna and making it protein. Regulaion is achieved through operons; geneic switches that control transcripion (on/of) Regulate gene expression through operons; these are a region/are that allows for diferent on/of switches. Lac operon is a short dna sequence between the promoter and lacz gene. Have dna strand, ahead there is a regulatory gene, when transcribed it produces a mrna that can be translated to a lac repressor protein. Called lac, because it"s under control and depends on concentraion of lactose in the cell. Protein has ability to control if transcripion can occur or not. In operons/coding region is comprised of more than one gene. Coding region has 3 separate mrnas, one ater another without each requiring their own promoter, all under control of the same promoter.

Related Questions

1. What is the term when the product of a biochemical pathway inhibits the activity of the first enzyme of a pathway?

		feedback inhibition.
		activator inhibition.
		diffusional regulation.
		enzyme activation.

2. Through control of gene expression, prokaryotes respond to changing __________ conditions.

		internal
		protein
		environmental
		genetic

3. A protein that negatively regulates transcription by binding to the operator is known as the

		operon
		repressor
		activator
		inducer

4. During attenutation, when tryptophan levels are high, the ________ stem-loop forms and transcription ________ the trpL gene.

		1-2, ends just past
		3-4, ends just past
		1-2, continues beyond
		3-4, continues beyond

5. The process of turning on the expression of a gene in response to a substance in the environment is called:

		constituation.
		repression.
		induction.
		catabolism.

6. What is a function of some specific transcription factors?

		to bind to the promoter region of the gene to facilitate the proper alignment of the RNA polymerase
		to bind to the centromere to induce meiosis
		to bind to enhancer regions to help regulate gene transcription
		to bind to the operator to recruit sigma factor

7. How does exposing an E.coli cell to glucose affect the regulation of the lac operon via CAP?

		cAMP binds to CAP and transcription is increased.
		cAMP binds to CAP and transcription is decreased.
		cAMP does not bind to CAP and transcription is increased.
		cAMP does not bind to CAP and transcription is decreased.

8. The lac repressor protein works when mutations in the repressor gene and structural genes are:

		in cis or in trans.
		in trans only.
		in cis only.
		in both prokaryotes and eukaryotes.

scarletwombat949

Question 4

Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)

Guanine

histone

Double helix

Adenine

conservative

cytosine

Okazaki fragments

Thymine

introns

Leading strand

RNA polymerase

5-prime to 3-prime

Uracil

chromatin

DNA ligase

Semi-conservative

promoter

Lagging strand

DNA polymerase

nucleosomes

Electron transport chain

enhancer

Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.

Question 5

In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."

Lactose	Glucose	Lac expression?
No	Yes
Yes	Yes
Yes	No

Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.

Question 6

Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)

a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5âAUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3â

b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.

c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

plumgoat220

BIO 1140 Lecture Notes - Lecture 15: Lac Repressor, Allolactose, Repressor

Document Summary

Get access

Related textbook solutions

Molecular Cell Biology

Biology: Science for Life with Physiology

Concepts of Biology

Biology

Essentials of Biology

Related Documents

BIO 1140 Lecture Notes - Lecture 15: Lac Repressor, Repressor, Allolactose

BIO 1140 Lecture 14: Transcription pt. 2

BIO 1140 Lecture Notes - Lecture 15: Allolactose, Operon, Repressor

Related Questions