CS 105 Study Guide - Final Guide: Empty String, Selection Sort, Binary Search Algorithm

• School: University of Illinois
• Department: Computer Science
• Course: CS 105
• Professor: All

Document Summary

In biology, messenger rna (mrna) is a family of rna molecules that convey genetic information from dna to the ribosome. Since this process is critical for protein production and gene expression, analysis on mrna is extremely common. For the next ten questions, you will be doing some simple analysis on mrna. For example, the following string is a representation of some mrna: var mrna = gaaaugccauucaaagauuaa; Instead of trying to make sense out of a long string, mrna is often read as a series of codes. Uaa: we can express this sequence of codes as an array in javascript: var a = [gaa, aug, cca, uuc, aaa, gau, uaa] In javascript, which of the following accesses the element of the array a with the value. cca: a[1, a[2, a[3, a[cca, cca[a, suppose we want to search the array from the previous question for a specific code.