MCB 2410 Study Guide - Quiz Guide: Sonic Hedgehog, Northern Blot, Contig
Name: Section
MCB 2410 Quiz 12
!
1.!Last week, you did a PCR of the Sonic Hedgehog
cDNA. You want to sequence the following piece
of DNA.
!
5’- CTCCAGCCTTGGTTGTAACGTAGAATAAAGCG -3’
You use the primer 5’ TATTCT 3’ to perform
the sequencing reaction. Fill in the gel to the
right with the expected results of this
sequencing experiment. (1 pt)
(Fill in one band on each of the dotted lines.)
Within the boxes provided, label the ends of
the gel with the orientation of the DNA
fragment you generate. (1 pt)
2.!How does the structure of ddNTPs differ from
that of dNTPs? (1 pt)
No 3’ -OH
3.!Sonic Hedgehog may play a role in normal neural cell apoptosis. You perform a
microarray on cDNA from wild type neural cells and cDNA from cancerous neural
cells that routinely avoid apoptosis.
The wild type cDNA is labeled red
The cancerous cDNA is labeled green
a.!What do yellow spots represent? Are these good candidates for further
investigation? (2 pts)
Yellow spots represent genes that are expressed at equal levels.
Because transcription levels do not change as the cells become
cancerous, they are not good candidates for further research.
b.!Which color(s) represent tumor suppressors that promote apoptosis? (1 pt)
Tumor suppressors that promote apoptosis would be
downregulated in this cancer, so the spots would appear red (wild
type).
c.!Which color(s) represent oncogenes that may help cancer cells avoid
apoptosis? (1 pt)
Oncogenes that help cells avoid apoptosis would be upregulated in
these cancer cells, so the spots would appear green.
4.!What is the technique that allows scientists to detect only one RNA sequence of
interest at a time? (1 pt)
Northern Blot
3’
5’
https://www.coursehero.com/file/20427774/MCB2410-GenomicsQuizV1key-F16Week131/
This study resource was
shared via CourseHero.com
Document Summary
Last week, you did a pcr of the sonic hedgehog cdna. You want to sequence the following piece of dna. 5"- ctccagccttggttgtaacgtagaataaagcg -3" you use the primer 5" tattct 3" to perform the sequencing reaction. Fill in the gel to the right with the expected results of this sequencing experiment. (1 pt) (fill in one band on each of the dotted lines. ) Within the boxes provided, label the ends of the gel with the orientation of the dna fragment you generate. (1 pt) 2. How does the structure of ddntps differ from that of dntps? (1 pt) no 3" -oh 3. Sonic hedgehog may play a role in normal neural cell apoptosis. You perform a microarray on cdna from wild type neural cells and cdna from cancerous neural cells that routinely avoid apoptosis. The wild type cdna is labeled red the cancerous cdna is labeled green a.