CAS BI 203 Study Guide - Quiz Guide: Polymerase Chain Reaction, Restriction Fragment Length Polymorphism, Taxus Baccata

361 views13 pages

Document Summary

Snp pattern found in individuals affected with a disease is compared to the snp pattern found in unaffected individuals. If an individual has a shift in nucleotide aka snp, then its offspring will also have that shift. You will need to follow the steps of replication. Question: dna differences can be used to identify people. 3 gggacccgagacatttcttatcacacaactaagaaatagggtttacaaagattcac5 : strands are synthesized in the 5 --> 3 direction, to assist the investigators with the crime, you will need to perform polymerase chain. Reaction (pcr) to create copies of this gene so the sizes can be compared to determine if the blood was from a man or woman. During pcr it will be necessary to break the hydrogen bonds of the base pairs. Place the steps listed below in the order in which they occur during replication: a) two strands, one new and one original template, wind together to form the double helix.

Get access

Grade+
$40 USD/m
Billed monthly
Grade+
Homework Help
Study Guides
Textbook Solutions
Class Notes
Textbook Notes
Booster Class
10 Verified Answers

Related Documents

Related Questions