BIOL 102 Study Guide - Final Guide: Dna Replication, Hydrogen Bond, Chromosome

Question 4

Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)

Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.

Question 5

In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."

Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.

Question 6

Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)

a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5’AUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3’

b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.

c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

magine that the year is 1928 and the scientific world is in an uproar trying to determine what component of the cell isresponsible for genetic inheritance. Is it DNA, protein, perhaps even RNA? You are busy in your lab, trying to help solve this crucial mystery that still plagues (then) modern day biology. Your work focuses on a microorganism, a bacterium named Streptococcus pneumoniae, and its effects on mice. There are two strains of S. pneumoniae (which is responsible for pneumonia), the “Rough” strain (R) and “Smooth” strain (S). The strains are very similar except the S strain has a smooth polysaccharide coat that enables the microorganism to avoid the organism’s immune system and cause illness (and death in mice). The R strain has a rough coat which is detected and dealt with by the immune system (and as a result causes no death in mice). You decide to perform a series of experiments using the R and S strain of S. pneumoniae involving injections of these strains in mice. Your results are documented in the figure below: living S strain of S. pneumoniae mouse dies of infection living R strain of S. pneumoniae mouse lives mouse lives S strain heat-killed living R strain mouse dies of infection living, pathogenic S strain recovered S strain heat-killed From these results, you figure out that something from the heat killed S strain is transforming the R strain into the virulent strain. What is this “Transforming principle”? Is it related to the cellular component that was passed from one generation to the next? As you know, this was the initial experiment performed by Dr. Frederick Griffith that eventually led to the discovery of the true cellular component that is the genetic inheritance molecule as well as the “transforming principle” (Hint: It’s DNA!).

1. Several experiments were required to demonstrate how traits are inherited. Which scientist or team of scientists first demonstrated that cells contain some component that can be transferred to a new population of cells and permanently cause changes in the new cells?

a. Griffith b. Watson and Crick c. Avery, MacLeod, and McCarty d. Hershey and Chase

2. From your results, which one of the cellular components can be determined NOT to be the component responsible for genetic inheritance? Why?

a. Proteins because these macromolecules become denatured with heat. b. DNA because these macromolecules form a single helix in solution. c. RNA because it's double stranded 100% of the time d. Sugars because glycolysis happens.

3. Which one of the following experimental trials below are considered to be controls for this experiment? a. S Strain grown in 10% ethanol medium. b. Living S strain; Living R strain; Heat Killed S Strain c. Living R Strain with heat killed S strain; Living S Strain d. Heat Killed S strain; Living R strain; R strain grown in 10% ethanol medium

4. Which scientist or team of scientists obtained definitive results demonstrating that DNA is the genetic molecule? a. Griffith b. Watson c. Crick d. Hershey and Chase

5. Hershey and Chase used radiolabeled macromolecules to identify the material that contains heritable information. What radioactive material was used to track DNA during this experiment?

a. 3H b. 14C c. 35S d. 32P

6. DNA molecules, like proteins, consist of a single, long polymeric chain that is assembled from small monomeric subunits.

a. True b. False

7. The polarity of a DNA strand results from the polarity of the nucleotide subunits.

a. True b. False

8. There are five different nucleotides that become incorporates into a DNA strand.

a. True b. False

9. Hydrogen bonds between each nucleotide hold individual DNA strands together.

a. True b. False