Biology 1002B Lecture Notes - Lecture 9: Tata Box, Genetic Code, Bind

34 views5 pages

greenduck439

20 Apr 2016

School

Western University

Department

Biology

Course

Biology 1002B

Professor

Beth Mac Dougall- Shackleton

For unlimited access to Class Notes, a Class+ subscription is required.

Document Summary

Identify the sequence of standard start and stop codons. The start codon is aug in rna, tac in the template strand. The stop codon can be uaa, uga, and uag in the rna. Identify the function of start and stop codons. Start codons are the signal for the start for translation, coding for the protein methionine. Stop codons do not code for any proteins (in essence, they don"t code for amino acids). A release factor binds to the ribosome when it encounters a stop codon and terminates translation. Stop codons act as periods: indicating the end of a polypeptide- encoding sentence. In prokaryotes translation begins as soon as there is any mrna available- as soon as the. Eukaryotic gene expression: no sd box- instead, small subunit of ribosome recognizes 5" cap, binds to it and moves along the mrna (scanning) Cleaving of polyadenylation signal signified termination of transcription.

Related Questions

Below is a DNA sequence that is a template strand and contains an Open reading frame for a gene:

3â TAAACTGTACAGGGCCATAACT 5â

A. Find the open reading frame and circle the start and stop codon.

B. Transcribe the open reading frame into a strand of mRNA

C. What is the peptide encoded by this strand of mRNA?

D. Consider the 2nd translated codon from the mRNA strand. What is the probability that a single base change in any position of this codon would change the identity of the second amino acid in the protein sequence?

Match the following:

1	Region which lies upstream of thetranslation start site contains the Shine Dalgarno sequence
2	Sequence added to the 3' end of thepre-mRNA which affects mRNA stability
3	Establishes the reading frame andspecifies the first amino acid of the protein chain
4	DNA sequence that the transcriptionapparatus recognizes and binds to initiate transcription
5	Expressed sequences of DNA that arenot removed during alternative splicing
6	Signals the end of translation andthe protein molecule
7	Group of three nucleotides that codefor an amino acid
8	Site begins the coding region of thegene and is located 25-30 nucleotides downstream of the TATAbox
9	Non-coding sequences of DNA thatintervene within coding regions of a gene
	10 Ribosome binding site ineukaryotes; functions in the initiation of translation and mRNAstability
11	A sequence which lies downstream ofthe coding region of the gene; determines the location of the 3'cleavage site in the pre-mRNA molecule
12	Sequence of nucleotides at the 3' endof the mRNA that is not translated into protein; affects thetranslation and stability of the mRNA molecule

A.	5' untranslated region
B.	AAUAAA consensus sequence
C.	Promoter
D.	Transcription start site
E.	3' untranslated region
F.	Introns
G.	Initiation codon (AUG)
H.	Poly(A) tail
I.	5' cap
J.	Termination codon (UAA, UGA, UAG)
K.	Exons
L.	Sense codon

ivorymacaw91

QUESTION 1

Each triplet codon encodes for a unique amino acid

True

False

QUESTION 2

The codon and anticodon are always antiparallel to each other when base-paired.

True

False

QUESTION 3

Which one of these is not a stop codon:

	(a)	UAA
	(b)	UAG
		(c) UAC
		(d) UGA

QUESTION 4

In Prokaryotic translation which of the following occurs:

		a) the 50S ribosome joins with the 60S initiation complex to allow for initiation
		b) The AUG is identified by being 20 nucleotides downstream of the shine-dalgarno sequence
		c) GTP is hydrolyzed as initiation factors are released
		d) A 45S initiation complex is formed by numerous factors, including mRNA

QUESTION 5

The extended polypeptide chain occurs in the E site in the ribosome

True

False

coffeeswan749

Biology 1002B Lecture Notes - Lecture 9: Tata Box, Genetic Code, Bind

Document Summary

Get access

Related Documents

Biology 1002B Chapter Notes - Chapter 13: Ribozyme, Inosine, Peptidyl Transferase

Biology 1002B Lecture Notes - Lecture 6: Permease, Catabolite Activator Protein, Cyclic Adenosine Monophosphate

Biology 1002B Study Guide - Stem-Loop, Start Codon, Riboswitch

Related Questions