BISC 101 Lecture Notes - Lecture 4: Post-Translational Modification, Pyrimidine, Purine
![](https://new-preview-html.oneclass.com/Exbq3r4gwdYONPXbpppxNy1MLBo2plvz/bg1.png)
BISC 101-DNA TRANSCRIPTION/TRANSLATION---PROTEIN SYNTHESIS
Key points
• DNA to protein= DNA-coded gene is usually transcribed into mRNA and sent out of the nucleus to be
translated into proteins within the cytoplasm
• purine has TWO rings = C5H4N4 (guanine, adenine); pyrimidine has ONE ring= C4H4N2 (cytosine,
thymine--- with RNA, thymine is replaced by uracil)
• if one purine pairs with one purine then it is too long, if one pyrimidine pairs with one pyrimidine then it is
too short; these two ases wo’t e struturall suitale to for a doule heli---this is the reason why
one purine must pair with one pyrimidine
DNA = A-T, G-C
RNA = A-U, G-C
• A-T= two hydrogen bonds; G-C= three hydrogen bonds.
• Nucleotides are joined by phosphodiester likage 3’-5’---H-bonds are keys to how two strands are joined.
• The two strands are antiparallel--- oe strad rus fro 3’ to 5’, the other strad rus fro 5’ to 3’
• Steps in making proteins: 1. Transcription 2. mRNA slicing 3. Translation
4. Post-translational modification
find more resources at oneclass.com
find more resources at oneclass.com
Document Summary
Rna = a-u, g-c: a-t= two hydrogen bonds; g-c= three hydrogen bonds, nucleotides are joined by phosphodiester li(cid:374)kage 3"-5"---h-bonds are keys to how two strands are joined. The two strands are antiparallel--- o(cid:374)e stra(cid:374)d ru(cid:374)s fro(cid:373) 3" to 5", the other stra(cid:374)d ru(cid:374)s fro(cid:373) 5" to 3". 5" ccatataaacccgcccgactgatcatgctagcaagctgagaaggcctaa 3": tata box is upstream from the starting point--- tata box + start point = promoter, rna polymerase reads the template strand fro(cid:373) 3" to 5" (cid:271)ut it sy(cid:374)thesizes (cid:373)rna fro(cid:373) 5" to 3"= Rna polymerase only adds (cid:374)u(cid:272)leotides fro(cid:373) the 3" e(cid:374)d. Transcription factors bind to dna when they see tata box. Rna polymerase follows and binds to dna also. More transcription factors bind to dna along with the first few transcription factors and. Rna polymerase forming a unit called transcription initiation complex. Transcription initiation complex will start to break bonds and untwist dna double helix to do base-pairing by adding rna nucleotides that are complementary to the template strand.