BIOL 2002 Chapter Notes - Chapter 20: Ti Plasmid, Plant Cell, Severe Combined Immunodeficiency

42 views3 pages

indigoraccoon472

2 Apr 2017

School

Department

Course

Professor

For unlimited access to Textbook Notes, a Class+ subscription is required.

Document Summary

Genome = complete genetic composition of a cell, organism or species. Segments of chromosomes are cloned and analyzed and mapped. Complete dna sequence provides the most detailed description of an organism"s genome at the molecular level. Functional genomics - studies expression of a genome. Bacterial artificial chromosome can contain large inserted dna fragments. Derived from large plasmids called f factor. Used in research similar to other vectors. Yeast artificial chromosomes are used as vectors in yeast. Mapping - process of determining the relative locations of genes or other dna segments along a chromosome. Physical mapping - determine relative locations of cloned pieces as they would occur in an intact chromosome. Each vector contains a clone with regions that overlap its neighbors. Contig - clones are assembled into a series of contiguous overlapping dna fragments. Dna sequencing - method of determining the base sequence of dna. Dideoxy chain termination method - dideoxy sequencing - used for dna sequencing.

Related Questions

I just need someone to interpret exactually what I'm suppose todo here. I understand how to compare the sequecnces, however Idon't know exactually how to put them in order. also I can't findout how to find the what chromosome the sequence came from. So farall I gather to do from this is to find which segments overlap, addthe length, tell how big the chromesomeContigs and ShotgunSequencing
In this chapter, we discussed how wholeâgenome shotgun sequencingmethods can be used to assemble chromosome maps. Recall that in thetechnique of shotgun cloning, chromosomal DNA is first digestedwith different restriction enzymes to create a series ofoverlapping DNA fragments called contiguous sequences, or"contigs." The contigs are then subjected to DNA sequencing, afterwhich bioinformaticsâbased programs are used to arrange the contigsin their correct order on the basis of short overlapping sequencesof nucleotides.

In this Exploring Genomics exercise, you will carry out asimulation of contig alignment to help you understand theunderlying logic of this approach to creating sequence maps of achromosome. For this purpose, you will return to the NationalCenter for Biotechnology Information BLAST site that was used inother Exploring Genomics exercises and apply a DNA alignmentprogram called bl2seq.

Exercise I: Arranging Contigs to Create a Chromosome Map
1. Access BLAST from the NCBI Web site athttp://www.ncbi.nlm.nih.gov/BLAST/. Locate and select the "Aligntwo sequences using BLAST (bl2seq)" category at the bottom of theBLAST home page. The bl2seq feature allows you to compare two DNAsequences at a time to check for sequence similarityalignments.

2. Below are eight contig sequences taken from an actual humanchromosome sequence deposited in GenBank. For this exercise we haveused short fragments; however, in reality contigs are usuallyseveral thousand base pairs long. To complete this exercise, copyand paste two sequences into the Align feature of BLAST and thenrun an alignment (by clicking on "Align"). (Hint: Access thesesequences from the Companion Web site so that you can copy andpaste the sequences easily.) Repeat these steps with othercombinations of two sequences to determine which sequences overlap,and then use your findings to create a sequence map that placesoverlapping contigs in their proper order. A few tips toconsider:

â¢Develop a strategy to be sure that you analyze alignments for allpairs of contigs.
â¢Only consider alignment overlaps that show 100 percent sequencesimilarity.
Sequence A
CTAATTTTTTTTGTATTTTTAATAGAGACGAGGTGTCACCATGTTGGACAGGCTGGTCTCGAACTCCTGACCTCAGGTGATCTGCCCACCTCAGCCTCCCAAAGTGCTGGGAT
TACAAGCATGAGCCACCACTCCCAGGCTTTATTTTCTATTTTTTAATTACAGCCATCCTAGTGAATGTGAAGTAGTATCTCACTGAGGTTTTGATTTGCATTTTTCTATGACA
ATGAACAATGTTTCATGTGCTTGTTGGCTGTTTGTATATCCTTTTTGGAGAAATACCAATTCATGTCCTTTGCCCATTTTTAAAGTGGATTGCATGTCTTTTTGTTGTTTAGT
TGTAAAGATGTGGGTTTTTCTTTTGAGACGGAGTCTCGCTGTCGCCTAGGCTGGAGTGCAGAGGCATGATCTCGGCTGACTGCAATCCCCACCTCCTGGCATCAAGAAGTTCT
CCTGCCTCAGCCTTCCAAGTAGCTGGGTTTACAGATGC

Sequence B
CTTTATCTCAGGACAATGAACCCGCAAGGAGAGGAAGAGCCAGTAATTCTATAGAGACTCGGAGGCGCAGGGGGCACGCTTAGTTAGAGTGGTGGTGGTATTTTCAGTGTTTT
CTGGTTTTATGATAAACACAAGCATCAATGTCTCAAGACTTTCATCTTTATCTTTTTTTTTTTTTTTTTTTTTTTCTTGAGACAGGGTTTCCCTCTGTCACCCAGGCTGGAGT
GCATTGGTGGTGTGATCTTGGCTTTCTGTAACCTCGGGCTTCTGGGCTCAAGCCGTTCTACTACCTCAGCCTCCCAAATAGCTAGAACTACAAGCGTGTGCTGCCACACCTGG
CTAATTTGTTGTATTTTATTTATTCATTTATTTTTGTGAAGACAAGGTCTTGCCATGTTGCCCAGGCTGGTCTCAGACTCCTGGGCTCAAGCAATCCACCCACCTTAGTCTCC
CAAAGTGCTGGGATTACAGGCGTGAGCCACCACACCCA

Sequence C
GGAATTTCACTCTTGTTGCCCAAGTTGGAGTGCAATGGCGCGATCTCAGCTCACTGCAACCTCCGCCTCCCAGGTTCAAACGATTCTCCTGCTTCACTCTCCCCAGTAGCTGG
GATTACAGGCTGCACCACCACACCTGGCTAATTTTTTTTGTATTTTTAATAGAGACGAGGTGTCACCATGTTGGACAGGCTGGTCTCGAACTCCTGACCTCAGGTGATCTGCC
CACCTCAGCCTCCCAAAGTGCTGGGATTACAAGCATGAGCCACCACTCCCAGGC

Sequence D
GCTTCATCTTTCTCTTCACCGTAAAACAGGAAAGTGTGTGGTGACCAGTATTTTAAGGGAAAGGCACTTACAGAGAATTAAGCATTTGACAAAATTTATTTACAGATATTTGT
CTGTGGACCACTTCCGCACCAGCTGTGCATGAGAGGGCTCATTGCTCTGAATTTGCCTCCTTGTCTGCACCCAGGAGACCGTTTCCCAGATCACGCAAACGCTGCCTTCTCCC
CACACCAGGGCCCTCAGCATGGGAATGACCTTCCAGCGCTGCACGTTTCCAATCCATGCTCTGTTTTTCAGTTCTGGCTCACAGAGGACTGCTGGTTGCAAGCAAACTTGTAT
CTGGGTCTTCA

Sequence E
CCTTAAGTGATCTACCTGTCTCTGCCTCTCAAAGTGCTGGGATTGCAGGCATAAGCCGCCATGCCCGGCCCAAAGTTTCTTTATATGTGCTGGATACTAGGCCCGTAACAGAT
ATACAATTTGTAAATATTTTCTCTCATTTTGAAGATTTTCTTTTCACTTTCTTGATAATGTCCTTTGTGTATTTTTTGATAATGTCCTTTGATACACAAAAGTTTTTAAGTTT
GATGAAGTTCAATTTACCTATTATTTTCTTTTGTTGTTCAT

Sequence F
TGTTTGTTTGTTTGTTTTGTTTCATTTTGTTTTTGAGACAGAGTCTTGTTCTGTCGCCCAGTGTAGAGTGCAGTGGCATAATCTCGGCTCACCGTAACCTCCGCCTCCCGGGT
TCAAGCAACTCTGCCTGCCTCAGCCTCCCAAGGAGCTGGGATTATAGACGCCCACCACCATGCCTGGTTAATTTTTGTAGTTTTTTTTAGTAGAGATGGGGTTTTGCCATTTT
GGCCAGGCTGGTCTTGAACTCCTGACCTCAGGTGATCTGCCCACCCTGGCCTCTCAAAGTGCTGGGATTACAGGTGTGAGCTGCCACACTCGGCCACAACAAATTTTTGCACC
AGTTGCTCACA

Sequence G
TCCTTTGATACACAAAAGTTTTTAAGTTTGATGAAGTTCAATTTACCTATTATTTTCTTTTGTTGTTCATTCATTTTGTGTCCTATGTAGGAATCTATTGCCAAATTCAAGGT
GATAAAGATTTACCCCTATGTTTCCTTCTAAGAGTTTTATTGTTTTAGCCCTGATATTTAGCTAAACTTAATTGATTTATTAAGTTTAATTTTCCTATGTGGTATGAAGTCAT
TTATCTTCTTTAGTTCAGGATCCAAGTGAAAGGGGCATCTTCTATCTGGGACATGCCATTCTCATGACAGAGGAAAAAGACAAAAAACTGACACATACAATGACTTTAAAACT
TCACTCA

Sequence H
GGGTTTTTCTTTTGAGACGGAGTCTCGCTGTCGCCTAGGCTGGAGTGCAGAGGCATGATCTCGGCTGACTGCAATCCCCACCTCCTGGCATCAAGAAGTTCTCCTGCCTCAGC
CTTCCAAGTAGCTGGGTTTACAGATGCCCACCACCATGCCTGGCTGGTTTTTGTATTTTTAGTAGACACGGGGTTTTACCATGTTGGCCGGGCTGGTCTGGAACTCCTAACCT
TAAGTGATCTACCTGTCTCTGCCTCTCAAAGTGCTGGGATTGCAGGCATAAGCCGCCATGCCCGGCCCAAAGTTTCTTTATATGTGCTGGATACTAGGCCCGTAACAGATATA
CAATTTGTAAA

3. On the basis of your alignment results, answer the followingquestions, referring to the sequences by their letter codes (Athrough H):

a.What is the correct order of overlapping contigs?
b.What is the length, measured in number of nucleotides, of eachsequence overlap between contigs?
c.What is the total size of the chromosome segment that youassembled?
d.Did you find any contigs that do not overlap with any of theothers? Explain.
4. Run a nucleotideânucleotide BLAST search (BLASTn) on any of theoverlapping contigs to determine which chromosome these contigswere taken from, and report your answer.
segment is, and what chromosome it came from. here's theassignment. I just need someone to interpret how I should go aboutdoing this.

viridianox52

BIOL 2002 Chapter Notes - Chapter 20: Ti Plasmid, Plant Cell, Severe Combined Immunodeficiency

Document Summary

Get access

Related Documents

MCELLBI 104 Lecture Notes - Lecture 18: Shotgun Sequencing, Plasmid, Genomic Library

MCB 2050 Lecture Notes - Lecture 2: Restriction Fragment Length Polymorphism, Genomic Library, Hindiii

BIOL 2344 Lecture Notes - Lecture 15: Shotgun Sequencing, Pyrosequencing, Molecular Cloning

Related Questions