ARAB 2101 Chapter : Cardinal Numerals

12 views5 pages

azuremammoth471

15 Mar 2019

School

Department

Course

Professor

For unlimited access to Textbook Notes, a Class+ subscription is required.

Document Summary

I/ the arabic numerals are written and pronounced the following way: Ii/ the numerals 1 and 2 are adjectives and agree as such with the principal noun in case, state, gender and number. Each numeral from 1-10 has a masculine and a feminine form: nominative genitive accusative. Iii/ the rule of polarity: this rule applies to 3-10 in connection with countable nouns. A masculine countable noun is preceded by the feminine form of the numeral. A feminine countable noun is preceded by the masculine form of the numeral. The numeral and the noun are the 1st and 2nd term of a genitive construction. The noun is indefinite and takes the genitive plural: The numeral in connection with a feminine noun. The numeral in connection with a masculine noun. Iv/ the numerals 11-19 are . There is agreement in gender between the numeral , f. and the following noun. The noun takes the accusative singular: in connection with a feminine noun.

Related Questions

1.Go to the Justice Department's web page (www.usdoj.gov/) and look under Antitrust Division to find an interesting case of price-fixing. Analyze and write a summary of the case.

2. Cartels like OPEC collude to raise prices and restrict production in the same way as a monopoly. Firms or countries form cartels in an attempt to stabilize volatile markets, so as to reduce the risks inherent in these markets for investment and product development. There are legal restrictions on such collusion in most countries. However, some economists say that Pro Sports is a cartel. Do you agree? Explain.

beigeporpoise249

ACCT 326 Writing Assignment #4

When global firms like Home Depot and Target become prime targets for hackers, the attack themselves become front-page news. Firms like these have invested a ton of resources (financial and non-financial) to prevent such an attack, but the attack is successful. Financial and personal data have been compromised, and now everyone wants answers. Your challenge is to argue the position of whether or not companies should be held liable for losses sustained in a successful attack made on their AIS applications (sales, billing, cash collections, credit, etc.) by hackers. In support of your argument, locate at least two cases where hackers breached a firm's AIS (or business system). Your first case must be either the Home Depot or Target case. The second case must be a case that involves a global entity. Your paper will consist of the following section
- Part I: What are the main facts from Case #1 (either Home Depot or Target, both not both)?

- Part II: What was the firmâs response to the attack and why (or why not) do you agree with their response?

- Part III: What are the main facts from Case #2 (remember, your case has to be a global one)?

- Part IV: What was the firmâs response to the attack and why (or why not) do you agree with their response?

- Part V: In general, why should the firm be held liable (or not held liable) for losses sustained by customers, employees, and suppliers per an attack by hackers?

- Part VI: In general, what can we learn from attacks by hackers, especially those who focus on ransomware

About Gene Cloning - EMERGENCY :(!!

Hello I have to write a report about the experiment I did aboutgene cloning and also have to answer few qns from the prof. I woudreally appreciate if anybody can help me and will thank you in apossible way. I am that desperate since this would be veryimportant for my grade :(

I don't know the insert gene and have to figure it out on NCBIBLAST search using the sequence.( I tried but I couldnt find onNCBI)

The cloning was with pGEX-4T-1 vector and unknown gene which isabout 700bp.

It says by using pGEX_3_primer, got the sequence, which would bereverse sequnece so I did reverse and it is

AAAATTAGTTTGTTTTAAAAAACGTATTGAAGCTATCCCACAAATTGATAAGTACTTGAAATCCAGCAAGTATATAGCA

TGGCCTTTGCAGGGCTGGCAAGCCACGTTTGGTGGTGGCGACCATCCTCCAAAATCGGATCTGGTTCCGCGTGG

ATCCACCGGTCGCCACCATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCA

AGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGA

GGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTC

AGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCG

AGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCT

GCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAA

GAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAG

CAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGT

GCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAA

CAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTAGCGGCCGC

Then the qn is,

1.What is this gene? Where is the start and stop codon of thisgene coding sequence?

2.Would this gene translated in in-frame? Gst fusion?

3.What is the partial expected amino acid sequence of GST-YFPprotien?

4.Can you find the restriction enzyme site that we used? (BamHI,NotI)

5.To check weather the cloning was done or not, it is better touse one restriction enzyme that is on vector and the other is oninsert. In this case we used the same emzyme as we used for cloningwhich are BamHI and NotI. If we want to still use NotI but changeBamHI as different enzyme, what could it be?

byzantiumdolphin29

ARAB 2101 Chapter : Cardinal Numerals

Document Summary

Get access

Related Documents

CRIM 2653 Chapter Notes - Chapter 1.5: Dosage Form, Syriac Versions Of The Bible, Ampoule

LINB18H3 Lecture 2: Lecture 2

HPS210H1 Lecture 5: HPS210 Lecture 5

Related Questions