LIFESCI 3 Study Guide - Midterm Guide: Prokaryote, Nucleophile, Lac Operon
Document Summary
Ls3 midterm i practice exam (10 pts) 1. Name:_________________________________ id __________________________ (last) (first) (9 pts) 3. Rna plays a key role in gene expression: name three advantages for a cell to have rna as an intermediate during gene expression. 3: name three ways in which the structure of rna differs from dna. Rna polymerase catalyzes the synthesis of rna that is complementary to the template strand of dna: draw two nucleotides below (use b1 and b2 for the bases) and indicate the chemical reaction catalyzed by rna polymerase. Name:_________________________________ id __________________________ (last) (first) (12 pts) 5. Consider the dna sequence below where both the 10 promoter region and +1 are underlined: 3"atccagacttcagcatgacgtacggatctaatatgcttcatgactg5" (4 pts) a) write the sequence of the rna synthesized from this promoter. Be sure to label the 5" (4 pts) b) why are the 10 and 35 regions of prokaryotic promoters conserved? (4 pts) c) rna synthesis involves a nucleophilic attack.
