BISC 1112 Study Guide - Spring 2018, Comprehensive Midterm Notes - Messenger Rna, Gene, Dna

90 views24 pages
12 Oct 2018
School
Course
Professor
BISC 1112
MIDTERM EXAM
STUDY GUIDE
Fall 2018
Unlock document

This preview shows pages 1-3 of the document.
Unlock all 24 pages and 3 million more documents.

Already have an account? Log in
Unlock document

This preview shows pages 1-3 of the document.
Unlock all 24 pages and 3 million more documents.

Already have an account? Log in
Quiz 3 (1) Transcription, Translation, Reprise BISC 1115
1
Transcription Post-Transcriptional Processing Amino Acid Activation Translation
o (1) Transcription- transcription of DNA to make RNA; transcription of DNA makes
complementary mRNA, rRNA, and tRNAs
o (2) Post-Transcriptional Processing of mRNA. Occurs after RNA is transcribed from DNA
template
1) Poly-A tail is added to 3’ end and a 5’-cap-
2) Introns are cut out of the RNA transcript
3) RNA exons are spliced/joined in the nucleus
o (3) Amino Acid Activation- attachment to transfer RNA. E/a amino acid is attached to its
appropriate tRNA by an Aminoacyl-tRNA synthase enzyme
Aminoacyl-tRNA synthase-
Process of attaching an amino acid to its appropriate tRNA by the respective
aminoacyl-tRNA synthase uses energy (ATP) releasing adenosine mono
phosphate (AMP) and 2 high energy phosphates
Insertion of the amino-acyl-tRNA in the A site of the ribosome uses energy from
GTP releasing GDP and 1 high energy phosphate
Also, movement of the tRNA from the A site to the P site used one more GTP
o (4) Translation of mRNA to make a protein. Translation of the code in mRNA in a
ribosome assembles amino acids to make a protein. The anti-code in the tRNA translates the
code in the mRNA
Practice Questions
Where is H-bonding involved in translation?
Codons are part of the molecular structure of ____? (mRNA)
Anti-codons are part of the molecular structure of ___? (tRNA)
What is the mechanism of information transfer in eukaryotes?
o A) DNA from a single gene is replicated and transferred to the cytoplasm where it serves as a
template for protein synthesis
o B) mRNA is transcribed from a single gene and transfers information from the DNA in
the nucleus to the cytoplasm, where protein synthesis takes place
o C) Proteins transfer information from the nucleus to the ribosome, where protein synthesis
takes place
o D) tRNA takes information from DNA directly to a ribosome, where protein synthesis takes
place
Which of the following occurs in prokaryotes but not eukaryotes?
o A) Post-transcriptional splicing
o B) concurrent transcription and translation
o C) Translation in the absence of a ribosome
o D) Gene regulation
Slide 22-1, 24-1, 26-1, - possible sequence
find more resources at oneclass.com
find more resources at oneclass.com
Unlock document

This preview shows pages 1-3 of the document.
Unlock all 24 pages and 3 million more documents.

Already have an account? Log in
Quiz 3 (2) Lecture Notes: Transcription in a Cell BISC 1115
1
Replication of DNA in the nucleus makes an identical copy of the DNA so the cell can divide
Transcription of some of the DNA makes complimentary mRNA, tRNA, and rRNAs. DNA
contains the information to make proteins; this involves transcribing the sequence of nucleotides in
the DNA to make an RNA sequence
Post-Transcription- mRNA is cut and spliced in the nucleus
Translation of the code in mRNA assembles amino acids to make a protein. Nucleotide sequences in
the RNA are translated in ribosomes to assemble amino acids to make a protein
The genetic Code- the code consists of sets of 3 nucleotides that are read in the 5’ to 3’ direction in
the mRNA
o 5’ GUC codes for valine, which has a nonpolar, hydrophobic chain. Use the genetic code
wheel to transcribe and translate a gene in a DNA sequence
o 5’ GAC codes for aspartic acid, which is acidic because it has a carboxyl group (-COOH)
DNA Template/mRNA
o 3’ TACGCTGAAAGTCTCCAGATTTGCTGG 5’
o 5’ AUGCGACUUUCAGAGGUCUAAACGACC 3’
find more resources at oneclass.com
find more resources at oneclass.com
Unlock document

This preview shows pages 1-3 of the document.
Unlock all 24 pages and 3 million more documents.

Already have an account? Log in

Document Summary

Bisc 1115: transcription post-transcriptional processing amino acid activation translation (1) transcription- transcription of dna to make rna; transcription of dna makes complementary mrna, rrna, and trnas (2) post-transcriptional processing of mrna. Insertion of the amino-acyl-trna in the a site of the ribosome uses energy from. Gtp releasing gdp and 1 high energy phosphate: also, movement of the trna from the a site to the p site used one more gtp (4) translation of mrna to make a protein. Translation of the code in mrna in a ribosome assembles amino acids to make a protein. The anti-code in the trna translates the code in the mrna. Quiz 3 (2) lecture notes: transcription in a cell. Bisc 1115: replication of dna in the nucleus makes an identical copy of the dna so the cell can divide, transcription of some of the dna makes complimentary mrna, trna, and rrnas. Regulation of transcription and gene expression in prokaryotes and eukaryotes.

Get access

Grade+20% off
$8 USD/m$10 USD/m
Billed $96 USD annually
Grade+
Homework Help
Study Guides
Textbook Solutions
Class Notes
Textbook Notes
Booster Class
40 Verified Answers