BPS3151 Quiz: Laboratory Assignment Class 4

109 views11 pages

ceriseshark335

30 Dec 2015

School

University of Ottawa

Department

Biopharmaceutical sciences

Course

BPS3151

Professor

Luc Poitras

For unlimited access to Study Guides, a Grade+ subscription is required.

Document Summary

>id|9587325 tuesday_202_gr3_m1_seqf1_p1308842_095. ab1 from 22 to 820 acaggagatatcatatggctcacaaccaccgtcacaaacacaagcttatgaacacgatta acatcgctaagaacgacttctctgacatcgaactggctgctatcccgttcaacactctgg ctgaccattacggtgagcgtttagctcgcgaacagttggcccttgagcatgagtcttacg agatgggtgaagcacgcttccgcaagatgtttgagcgtcaacttaaagctggtgaggttg cggataacgctgccgccaagcctctcatcactaccctactccctaagatgattgcacgca tcaacgactggtttgaggaagtgaaagctaagcgcggcaagcgcccgacagccttccagt tcctgcaagaaatcaagccggaagccgtagcgtacatcaccattaagaccactctggctt gcctaaccagtgctgacaatacaaccgttcaggctgtagcaagcgcaatcggtcgggcca ttgaggacgaggctcgcttcggtcgtatccgtgaccttgaagctaagcacttcaagaaaa acgttgaggaacaactcaacctgcgcgtagggcacgtctacaagaaagcatttatgcaag ttgtcgaggctgacatgctctctaagggtctactcggtggcgaggcgtggtcttcgtggc ataaggaagactctattcatgtaggagtacgctgcatcgagatgctcattgagtcaaccg gaatggttagcttacaccgccaaaatgctggcgtagtaggtcaagactctgagactatcg aactcgcacctgaatacgc. >id|9454002 template 1, seqf2 (sequence was obtained from ta) tcggtggcgaggcgtggtcttcgtggcataaggaagactctattcatgtaggagtacgct gcatcgagatgctcattgagtcaaccggaatggttagcttacaccgccaaaatgctggcg tagtaggtcaagactctgagactatcgaactcgcacctgaatacgctgaggctatcgcaa cccgtgcaggtgcgctggctggcatctctccgatgttccaaccttgcgtagttcctccta agccgtggactggcattactggtggtggctattgggctaacggtcgtcgtcctctggcgc tggtgcgtactcacagtaagaaagcactgatgcgctacgaagacgtttacatgcctgagg tgtacaaagcgattaacattgcgcaaaacaccgcatggaaaatcaacaagaaagtcctag cggtcgccaacgtaatcaccaagtggaagcattgtccggtcgaggacatccctgcgattg agcgtgaagaactcccgatgaaaccggaagacatcgacatgaatcctgaggctctcaccg cgtggaaacgtgctgccgctgctgtgtaccgcaaggacaaggctcgcaagtctcgccgta tcagccttgagttcatgcttgagcaagccaataagtttgctaaccataaggccatctggt tcccttacaacatggactggcgcggtcgtgtttacgctgtgtcaatgttcaacccgcaag gtaacgatatgaccaaaggactgcttacgctggcgaaaggtaaaccaatcggtaaggaag gttactactggctgaaaatccacggt. >id|9587117 tuesday_202_gr3_m1_seqf3_p1308842_013. ab1 from 24 to 900 gcggtcgccancgtaatcaccaagtggaagcattgtccggtcgaggacatccctgcgatt gagcgtgaagaactcccgatgaaaccggaagacatcgacatgaatcctgaggctctcacc gcgtggaaacgtgctgccgctgctgtgtaccgcaaggacaaggctcgcaagtctcgccgt atcagccttgagttcatgcttgagcaagccaataagtttgctaaccataaggccatctgg ttcccttacaacatggactggcgcggtcgtgtttacgctgtgtcaatgttcaacccgcaa ggtaacgatatgaccaaaggactgcttacgctggcgaaaggtaaaccaatcggtaaggaa ggttactactggctgaaaatccacggtgcaaactgtgcgggtgtcgataaggttccgttc cctgagcgcatcaagttcattgaggaaaaccacgagaacatcatggcttgcgctaagtct ccactggagaacacttggtgggctgagcaagattctccgttctgcttccttgcgttctgc tttgagtacgctggggtacagcaccacggcctgagctataactgctcccttccgctggcg tttgacgggtcttgctctggcatccagcacttctccgcgatgctccgagatgaggtaggt ggtcgcgcggttaacttgcttcctagtgaaaccgttcaggacatctacgggattgttgct aagaaagtcaacgagattctacaagcagacgcaatcaatgggaccgataacgaagtagtt accgtgaccgatgagaacactggtgaaatctctgagaaagtcaagctgggcactaaggca ctggctggtcaatggctggcttacggtgttactcgca. >id|9587237 tuesday_202_gr3_m1_seqf4_p1308842_014. ab1 from 19 to 949 gcaccacggcctgagctataactgctcccttccgctggcgtttgacgggtcttgctctgg catccagcacttctccgcgatgctccgagatgaggtaggtggtcgcgcggttaacttgct tcctagtgaaaccgttcaggacatctacgggattgttgctaagaaagtcaacgagattct acaagcagacgcaatcaatgggaccgataacgaagtagttaccgtgaccgatgagaacac tggtgaaatctctgagaaagtcaagctgggcactaaggcactggctggtcaatggctggc ttacggtgttactcgcagtgtgactaagcgttcagtcatgacgctggcttacgggtccaa agagttcggcttccgtcaacaagtgctggaagataccattcagccagctattgattccgg caagggtctgatgttcactcagccgaatcaggctgctggatacatggctaagctgatttg ggaatctgtgagcgtgacggtggtagctgcggttgaagcaatgaactggcttaagtctgc tgctaagctgctggctgctgaggtcaaagataagaagactggagagattcttcgcaagcg ttgcgctgtgcattgggtaactcctgatggtttccctgtgtggcaggaatacaagaagcc tattcagacgcgcttgaacctgatgttcctcggtcagttccgcttacagcctaccattaa caccaacaaagatagcgagattgatgcacacaaacaggagtctggtatcgctcctaactt tgtacacagccaagacggtagccaccttcgtaagactgtagtgtgggcacacgagaagta cggaatcgaatcttttgcactgattcacgactccttcggtaccattccggctgacgctgc gaacctgttcaaagcnnngcgcgaaactatg. >id|9587074 tuesday_202_gr3_m1_seqf5_p1308842_029. ab1 from 29 to 862 ttgggtaactcctgatggtttccctgtgtggcaggaatacaagaagcctattcagacgcg cttgaacctgatgttcctcggtcagttccgcttacagcctaccattaacaccaacaaaga tagcgagattgatgcacacaaacaggagtctggtatcgctcctaactttgtacacagcca agacggtagccaccttcgtaagactgtagtgtgggcacacgagaagtacggaatcgaatc ttttgcactgattcacgactccttcggtaccattccggctgacgctgcgaacctgttcaa agcagtgcgcgaaactatggttgacacatatgagtcttgtgatgtactggctgatttcta cgaccagttcgctgaccagttgcacgagtctcaattggacaaaatgccagcacttccggc taaaggtaacttgaacctccgtgacatcttagagtcggacttcgcgttcgcgtaagaatt cccgggtaccaagatcttgaatgaatgagctagctcgaccgatctcgacgagtgagagaa gattttcagcctgatacagattaaatcagaacgcagaagcggtctgataaaacagaattt gcctggcggcagtagcgcggtggtcccacctgaccccatgccgaactcagaagtgaaacg ccgtagcgccgatggtagtgtggggtctccccatgcgagagtagggaactgccaggcatc aaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcgg tgaacgctctcctgagtaggacaaatccgccgggagcggatttgaacgttgcga. Template 1, seqf2 that was provided by the ta. If the original sequence was used, partial assembly would have occurred. It was possible that two sequences differed at one nucleotide and the software automatically added an n because there was contradictory information: nucleotide-nucleotide alignment of the two sequences (clustaliw output)

Related Questions

1. How does the length of the recognition site determine the lengthof the DNA fragments produced by the restriction enzyme (frequencyof cutting)?

2. Identify 3 important features of cloning vectors?

3. How are Southern Blots, Northern Blots and Western Blotssimilar? How are they different?

4. What are the 3 main steps to a PCR cycle and what happens duringeach step?

5. What are the chemical components in a PCR reaction? How are thecomponents different in a sequencing reaction?

6. How is PCR similar to cloning? What are the advantages to PCRover cloning?

7. What are primers? How do they specify which segment of DNA isgoing to be amplified?

8. Could you perform whole genome sequencing from a cDNA library?Explain why or why not?

limeworm184

1. preparing a fatty acid to be catabolized through beta oxidation involves all of these except:

A. expenditure of 2 ATP equivalents.

B. attachment to carnitine.

C. crossing from the matrix into the cytosol through a translocase.

D. attachment to Coenzyme A

2. Ketone body formation

A. produces a water-insoluble fuel for brain cells.

B. occurs only under starvation conditions.

C. takes place in the cytosol.

D. allows acetyl CoA to be made into net glucose.

E. is favored when the citric acid cycle is inhibited.

3. Which statement concerning fatty acid synthesis is false?

A. Fatty acid synthesis from acetyl CoA requires ATP hydrolysis.

B. Fatty acid synthesis requires acetyl CoA to leave the matrix in the form of citrate.

C. Fatty acid synthesis takes place on a multifunctional enzyme complex.

D. Fatty acid synthesis is regulated at the carnitine transporter.

4. Cholesterol is transported from peripheral tissues to the liver as

A. chylomicrons.

B. VLDLs.

C. IDLs.

D. LDLs.

E. HDLs.

The most common route for a nitrogen atom removed from a branched amino acid in muscle tissue to formation of urea is

A. branched AA --> glutamate--> glutamine --> carbamoyl phosphate --> urea

B. branched AA --> alanine--> aspartate --> glutamine --> urea

C. branched AA --> aspartate--> alanine --> glutamate --> glutamine --> urea

D. branched AA Ã alanineÃ glutamate Ã carbamoyl phosphate Ã urea

E. branched AA Ã glutamateÃ arginine Ã carbamoyl phosphate Ã urea

teallizard787

1. Which of the following is the correct sequence of bloodflow?

a. heart --> atery --> arteriole --> capillary -->vein --> venule --> heart

b. heart --> vein --> venule --> capillary -->arteriole --> artery --> heart

c. heart --> artery --> arteriole --> capillary -->venule --> vein --> heart

d. heart --> artery --> venule --> capillary -->arteriole --> vein --> heart

e. heart--> artery --> capillary --> arteriole -->venule --> vein --> heart

2. What are the functions of the elastic fibers that are foundin the walls of ateries? (there may be more than one answer)

Select one or more:

a. they allow the artery to stretch and then recoil back to itsoriginal shape as blood is forcegully pumped from the heart intothe arteries

b. they allow arteries to lengthen as the volume of blood in thearteries increase

c. they help maintain a steady blood pressure during thedifferent phases of heart contraction

d. they smooth out the walls of the arteries to preventturbulent blood flow

3. Which of the following are functions of the lymphatic system?(there may be more than one answer)

Select one or more:

a. help fight infections and cancer

b. allows excess interstitial fluid (fluid found between thecells in your tissues) to get dumped back into your blood

c. brings large molecules from fat digestion into thebloodstream so that they can be processed and stored

d. all of the above are functions of the lymphatic system

4. Which of the following blood vessels bring newly oxygenatedblood from the blood vessels in the lungs back to the heart so thatthe heart can pump it to the rest of the body?

Select one:

a. aorta

b. inferior vena cava

c. pulmonary vein

d. pulmonary artery

5. Which of the following mechanisms help blood fight gravity sothat, for instance, it can return from blood vessels in your feetback into your heart? (there may be more than one answer)

Select one or more:

a. breathing allows the pressure in your chest to decrease andallow blood to flow up towards your heart

b. as you walk, the skeletal muscles in your legs contract andsqueeze the veins; since veins have valves, blood flows up anddoesn't backflow back down

c. the force of blood flowing out of the heart and into thearteries pushes all of the blood along, causing blood to return tothe heart

d. precapillary sphincters open to allow blood to flow backtowards the heart

6. The tricuspid and bicuspid/mitral valves prevent backflow ofblood from the atria into the ventricles.

Select one:

True

False

7. The following sequence represents the correct order of bloodflow through the heart:

inferior and superior vena cava --> right atrium --> rightventricle --> pulmonary artery --> lungs --> pulmonaryvein --> left atrium --> left ventricle --> aorta

Select one:

True

False

8. Capillaries are as wide as one red blood cell.

Select one:

True

False

9. The purpose of the coronary arteries is to bring oxygenatedblood to the walls of the heart so that the muscles in the heartwalls can contract.

Select one:

True

False

10. Vasodilation refers to the narrowing of blood vessels.

Select one:

True

False

ultramarinealligator67

BPS3151 Quiz: Laboratory Assignment Class 4

Document Summary

Get access

Related Documents

BPS3151 Study Guide - Quiz Guide: T7 Rna Polymerase, Open Reading Frame, Plasmid

BPS3151 Study Guide - Quiz Guide: Qiagen, Pbr322, Sanger Sequencing

BPS3151 Study Guide - Quiz Guide: T7 Rna Polymerase, Absorbance

Related Questions