BPS 3101 Study Guide - Midterm Guide: Oligomer, Start Codon, Bamhi

125 views16 pages

Document Summary

For a segment of sequenced dna that is suspected to contain an orf, Divide into triplets starting at positions 1, 2, and 3. 5" g c a a a g t t g t a g g g g a a g c t a a g c 3" Tip: if frame has stop codon, then it is not open . Reading frame # 3 is open over the whole region shown and its initiation codon may be located upstream of the given sequence. 5" gcaaagttgtaggggaagctaagctcgaaataaggtgtgcctatt 3" 3" cgtttcaacatccccttcgattcgagctttattccacacggataa 5" gene might be in opposite orientation, so examine 3 reading frames on complementary strand too. 5" gcaaagttgtaggggaagctaagctcgaaataaggtgtgcctatt 3" 3" cgtttcaacatccccttcgattcgagctttattccacacggataa 5" in real life we use computer programs to evaluate the 6 frames . Example of computer output for virtual translation shown in one-letter amino acid code. +3: k v v g e a k l e i r c a y.

Get access

Grade+20% off
$8 USD/m$10 USD/m
Billed $96 USD annually
Grade+
Homework Help
Study Guides
Textbook Solutions
Class Notes
Textbook Notes
Booster Class
40 Verified Answers

Related Documents

Related Questions