BIOL 1090 Study Guide - Final Guide: Phosphodiester Bond, Guanosine, Adenosine Monophosphate

1. Unlike DNA, RNA contains

deoxyribose

a double strand

phosphates

uracil

Nucleic acid structure

2. In transcription, uracil will bond with:

thymine

cytosine

adenine

guanine

Transcription

3. The first team of scientist to document the structure of DNA was:

Franklin and Wilkins

Watson and Crick

Pauling and Chargoff

None of the above

DNA structure

4. Organelles that synthesize protein are:

lysosomes

ribosomes

endoplasmic reticulum

golgi bodies

5. Most of the time in a cell's life, it's DNA is in the form of:

Chromatin

Chromatids

Replicated chromosomes

Spindle fibers

6. Uracil is a nitrogen base that pairs with adenine. Using this information, one could conclude that uracil is a:

Purine

Pyrimidine

Neither a purine or pyrimidine

Not enough information

7. a nucleotide does not consist of a:

polymerase

5-carbon sugar

phosphate group

nitrogen base

8. The genetic code in DNA of an individual depends on the sequence (order) of:

nucleotides

purines only

phosphates

sugars

9. Before a cell divides, it must duplicate its DNA in a process known as:

translation

transformation

transcription

replication

10. The basic unit (building block) of a protein is a (an):

carbohydrate

amino acid

lipid

hydrogen bond

11. Unlike DNA, RNA contains:

deoxyribose

a double strand

phosphates

uracil

12. The structure of DNA was first documented in:

1945

1953

1956

1962

13. In DNA replication, the new molecules produced are:

of unequal length

both assembled in the same direction

built with purines as the backbone

assembled in opposite directions

DNA replication

14. The "backbone" of DNA is composed of:

ribose and phosphates

deoxyribose and phosphates

ribose and uracil

deoxyribose and thymine

DNA structure

15. RNA differs from DNA in which of the following ways?

RNA is single-stranded

RNA contains ribose

RNA does not contain thymine

All of the above

DNA structure

16. Which of the following is NOT required for the transcription process itself?

RNA polymerase

DNA

uracil-containing nucleotides

ribosomes

1.Which of the following is not true about DNA? a) it is found both in the nucleus and the cytoplasm b)it is double stranded and the standards are connected by hydrogen bonds between the base pairs c) A purine base always pairs with a pyrimidine base to make up the DNA code d) it is the control center for both cell activity and heredity 2.Which of the following represents accurate base pairing in DNA ?a) Adenine to Adenine b)Adenine to Uracil c)Thymine to Cytosine d)Adenine to Thymine 3. Purines and Pyrimidines are found a) DNA only b)RNA only c) A and B d)In proteins 4.The bond that forms between carbohydrates is called a)peptide bond b) ester bond c) glycoside bond d)never ending bone 5. Which of the following does not dissolve readily in water? a)proteins b) amono acids c) steroids d) carbohydrates 6. The following arrangement of amino acids represents what level of structure ? ABACABDD a)Primary b)Secondary c)Tertiary d)Quaternary

Question 4

Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)

Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.

Question 5

In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."

Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.

Question 6

Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)

a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5’AUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3’

b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.

c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?