BIOL 200 : Answer Key.pdf

75 views8 pages

magentatermite154

9 Oct 2014

School

Department

Course

Professor

For unlimited access to Study Guides, a Grade+ subscription is required.

Document Summary

It is the only part of the primer synthesized by exclusively by primase. Crystallography: chargoff discovered that the ratio of purines to pyrimidines is 1:1, 1-2-3-4, 1-2-4-3, 3-2-4-1, 3-4-2-1, 2-1-4-3, dr. Evil decides to perform an experiment on dna. He cuts a sample of the b. evil gene using the restriction endonuclease ecor1. He then inserts the excised dna into a vacuum. He wants to find the sequence of this transposon in order to create a test that could detect anal cancer early to maximize the cure rate. When we put a sample of the dna in a spectrophotometer, we find that the absorbance wavelength is 260 nm (ultraviolet light) with an absorbance of 0. 8. Dna binding proteins could bind and begin the transcription/replication process: the polynucleotide backbone is much more stable in dna because rna is easily hydrolyzed, even at neutral ph. He decides to repeat the meselson-stahl experiment on zoggian dna.

Related Questions

PLEASE answer ALL THE QUESTIONS. DO NOT ANSWER IF YOU CANT ANSWER ALL OF IT.

3'- GGCCTTAAGCATGCATGCAT -5'

5'- CCGGAATTC(G)TACGTACGTA -3'

1. If a replication fork is moving from right to left along this DNA structure, which strand is the lagging strand template?

a) not enough information is provided

b) top strand

2. Which of the following occurs during Metaphase I of meiotic cell division?

a) Tetrads composed of homologous chromosomes line up at the center of the cell

b) homologous chromosomes separate

c) sister chromatid pairs line up at the center of the cell

d) non-sister chromatids exchange regions of DNA

3. A gerbil is a diploid organism with 58 chromosomes. Which of the following is true?

a) a gerbil cell in G2 phase has 58 chromosomes and 116 sister chromatids

b) a gerbil cell in Prophase has 58 chromosomes and 58 sister chromatid

c) a gerbil cell in Metaphase has 58 chromosomes and 58 sister chromatid

4. At the end of elongation and during the termination of replication on the leading strand, place the following events in the correct chronological order.

I. DNA pol I synthesizes DNA

II. DNA ligase seals the nicks in the daughter DNA

III. DNA pol I removes the RNA primers

IV. DNA pol III synthesizes DNA

a) IV-III-I-II

b)I-III-IV-II

c) III-I-II-IV

5. A gene for hair color (brown vs. blond) and a gene for finger length (long vs. short) are found on two different chromosomes. If a blond haired, long fingered mother is homozygous for hair color and homozygous for finger length, what is the probability that she passes along the preference for her son to have blond hair and long fingers?

a) 0%

v) 100%

c) 25%

6. For oxytocin signaling between two neurons, what is the correct order of events?

I. an oxytocin vessicle fuses with the plasma membrane

II. an oxytocin vessicle docks with plasma membrane

III. oxytocin molecules bind to the oxytocin receptor at the plasma membrane of the receiving neuron

IV. oxytocin molecules diffuse into the synapse

a) I-III-II-IV

b) II-I-IV-III

c) I-II-III-IV

7. The independent assortment of chromosomes is due to events that occur during ______.

a) meiosis I only

b) meiosis II only

c) mitosis and meiosis II

champagnemole592

1. The RAS proteinacquires a mutation that prevents release of GTP. Which of thefollowing characteristics are these cells likely toacquire?

A. Self-Sufficiency in growth signals
B. Insensitivity to anti-growth signals
C. Metastasis

2. Which of the following genes would you suspect to bea tumor supressor?
A. MSH2
B. CDK2
C. c-myc

3. A gene that is involved in a normal cellular processesbut when mutated contribute to cancer developmentis:
A. a proto-oncogene
B. a housekeeping gene

4. When a person carries a mutation in a tumor suppressorgene on one-chromosome and subsequently loses function of theirwildtype tumor suppressor allele, this describes:
A. gene conversion to an oncogene
B. loss of heterozygosity
C. haploinsufficiency

5. The mechanism by which alterations in DNA methylationcould promote carcinogenesis is:
A. by lengthening telomeres
B. by interacting with reactive oxygen species and thereforebecoming a potent mutagen
C. by either repressing or enhacing gene expression

6. When anaylzing a cell you find that it has aninactivating mutation in p53 and a mutation in the VEGF receptorthat makes activation independent of ligand binding. Which of thefollowing hallmarks would you expect the cell toexhibit?
I. self-sufficiency in growth
II. insensitivit to anti-growith signals
III. limitless replicative potential
IV. evading apoptosis
V. sustained angiogenesis

A. IV and V only
B. II, III, VI
C. I and III only

graywalrus182

I. Signaling cascades (4 pts)

1. Which of the following is an example of a signaling cascade?

A. Binding of lactose to the lac repressor

B. Binding of the lac repressor to the lac operon

C. The series of proteolytic digests that occur during clotting

D. The Collins Toggle Switch

2. Why is it important that signaling cascades have negative feedback loops?

II. Metabolism (4 pts)

1. What is a benefit of a negative feedback allosteric regulator?

A. It prevents starting materials from being unnecessarily consumed.

B. It regulated metabolism without requiring new protein synthesis.

C. It can be rapidly reversed as conditions change.

D. All of the above.

2. How is a metabolic cycle, like the citric cycle, distinct from a metabolic pathway, like glycolysis?

III. Transcription (4 pts)

1. Transcription factors, repressors, and activators are examples of proteins that _________.

A. randomly activate RNA polymerases.

B. bind specific DNA sequences.

C. bind specific rRNA sequences.

D. are found in the lysosome.

2. The trp operon is attenuated by a stem-loop structure that can form near RNA polymerase. The RNA sequencing encoding the stem loop is:

5â-AUACCCAGCCCGCCUAAUGAGCGGGCUU-3â

The stem loop is composed of 7 nucleotides which perfectly base pair. Indicate the two halves of the stem loop on the sequence above.

IV. DNA replication/repair/genome editing (4 pts)

1. What is a consequence of the need for RNA primers during DNA replication?

A. Linear chromosomes gradually shorten each cell division.

B. Transcription factors often trigger DNA replication.

C. RNA primers are not actually needed for DNA replication.

D. Lagging strands can be avoided.

2. CRISPR-mediated genome editing has gene-specific components: an sgRNA, and a double-stranded repair template. Describe the role of the sgRNA in directing genome editing.

V. Genetic circuits (4 pts)

1. Which statement best describes the mechanism of the toggle switch?

A. Inducers must be continuously applied to maintain one of two states.

B. Competing repressors keep the cell in one of two transcriptional states.

C. An activator and a repressor keep the cell in one of two states.

D. A pair of repressors cause the cell to oscillate between two states without input.

2. How is bistability achieved by the Collins toggle switch?

BIOL 200 : Answer Key.pdf

Document Summary

Get access

Related Documents

BIOLOGY 172 Lecture Notes - Lecture 12: Mreb, Cytoplasmic Streaming, Myosin Head

MCD BIO 165A Lecture Notes - Lecture 12: Adherens Junction, Intermediate Filament, White Blood Cell

BSCI 1511 Lecture Notes - Lecture 13: Endoskeleton, Myoglobin, White Meat

Related Questions